Q2
mcq
1 mark
Given below are a few statements with reference to the accessory ducts of the human male reproductive system:
(i) The seminiferous tubules of the testes open into rete testis then into the vas deferens.
(ii) The vasa efferentia leave the testes and open into the epididymis.
(iii) The epididymis leads to vas deferens that ascends into the abdomen.
(iv) The vas deferens receives a duct from the prostrate gland and opens into the urethra as ejaculatory duct.
(v) The urethra originates from the urinary bladder and extends through the penis to its external opening, urethral meatus.
Choose the option with all true statements from the given options:
- A. (i), (ii), (iv)
- B. (ii), (iii), (v)
- C. (ii), (iv), (v)
- D. (i), (iii), (iv)
Solution hidden
Log in to view solution →
Q3
mcq
1 mark
The substrate used during DNA replication by the enzyme DNA-dependent DNA polymerase is:
- A. Deoxyribonucleotide triphosphate
- B. Deoxyribonucleoside triphosphate
- C. Ribonucleotide triphosphate
- D. Ribonucleoside triphosphate
Solution hidden
Log in to view solution →
Q4
mcq
1 mark
In the given pedigree chart, a cross between a normal couple resulted in a son who was haemophilic and a normal daughter. In course of time, when the daughter was married to a normal man, to their surprise the grandson was also haemophilic.
Choose the option that indicates the correct inheritance of trait in the above pedigree chart:
- A. Autosome linked dominant trait
- B. Sex-linked dominant trait
- C. Autosomal recessive trait
- D. Sex-linked recessive trait
Solution hidden
Log in to view solution →
Q5
mcq
1 mark
In which of the following human diseases does defence mechanism attack self-cells?
- A. Thalassemia
- B. Phenylketonuria
- C. Filariasis
- D. Rheumatoid arthritis
Solution hidden
Log in to view solution →
Q6
mcq
Select the statements that are true for a typical dicotyledonous embryo from the given options.
(i) It consists of an embryonal axis and scutellum.
(ii) The portion of embryonal axis above the level of cotyledon is epicotyl.
(iii) The portion of embryonal axis below the level of cotyledon is coleorhiza.
(iv) The lower end of the embryo has radicle covered with a root cap.
Choose the correct answer:
- A. (i) and (ii)
- B. (i) and (iii)
- C. (iii) and (iv)
- D. (ii) and (iv)
Solution hidden
Log in to view solution →
Q7
mcq
About 15 mya during human evolution, the primates which used to walk like gorillas and chimpanzees were:
- A. Australopithecine and Neanderthal
- B. Dryopithecus and Ramapithecus
- C. Homo erectus and Homo sapiens
- D. Homo habilis and Homo erectus
Solution hidden
Log in to view solution →
Q8
mcq
Use the given information to select the amino acid attached to the $3'$ end of tRNA during the process of translation, if the coding strand of the structural gene being transcribed has the nucleotide sequence TAC.
Codons for the amino acids:
AUC Isoleucine
AUG Methionine
UAC Tyrosine
GUA Valine
Options:
- A. Isoleucine
- B. Methionine
- C. Tyrosine
- D. Valine
Solution hidden
Log in to view solution →
Q9
mcq
The technique for the early detection of a disease based on the principle of antigen-antibody interaction is:
- A. RNAi
- B. EST
- C. PCR
- D. ELISA
Solution hidden
Log in to view solution →
Q10
mcq
The correct depiction of the experiment performed by Matthew Meselson and Franklin Stahl to prove that DNA replicates semi-conservatively on separation of DNA by centrifugation after 40 minutes is:
Solution hidden
Log in to view solution →
Q11
mcq
Bioactive molecule Cyclosporin A used for human welfare is derived from:
- A. Propionibacterium sharmanii
- B. Monascus purpureus
- C. Trichoderma polysporum
- D. Aspergillus niger
Solution hidden
Log in to view solution →
Q12
mcq
In a pea plant $(Pisum\ sativum)$ inflated pod shape is dominant over constricted pod shape. The expected ratio of phenotypes of the offspring in a cross between both the parents with heterozygous inflated pod shape will be:
- A. 1 : 0
- B. 1 : 1
- C. 2 : 1
- D. 3 : 1
Solution hidden
Log in to view solution →
Q13
mcq
Assertion (A): in vitro -free plants from an infected plant.
Reason (R): If the plant is infected with a virus, the roots and the stems are free of virus.
Solution hidden
Log in to view solution →
Q14
mcq
Assertion (A): A person infected with malaria suffers from chill and high fever, recurring every three or four days.
Reason (R): The parasite attacks the RBC resulting in their rupture and release of haemozoin.
Solution hidden
Log in to view solution →
Q14
mcq
Assertion (A): A person infected with malaria suffers from chill and high fever, recurring every three or four days. Reason (R): The parasite attacks the RBC resulting in their rupture and release of haemozoin. Select the correct answer to these questions from the codes (A), (B), (C) and (D) as given below.
- A. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
- B. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
- C. Assertion (A) is true, but Reason (R) is false.
- D. Assertion (A) is false, but Reason (R) is true.
Solution hidden
Log in to view solution →
Q15
mcq
Assertion (A): increases phagocytosis of sperms.
Reason (R): It is a non-steroidal preparation.
Solution hidden
Log in to view solution →
Q16
mcq
Assertion (A): ABO blood grouping in humans is an example of multiple allelism.
Reason (R): More than two genes in a population govern the same character in ABO blood group
Solution hidden
Log in to view solution →
Q16
mcq
Assertion (A): ABO blood grouping in humans is an example of multiple allelism. Reason (R): More than two genes in a population govern the same character in ABO blood grouping in humans. Select the correct answer to these questions from the codes (A), (B), (C) and (D) as given below.
- A. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
- B. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
- C. Assertion (A) is true, but Reason (R) is false.
- D. Assertion (A) is false, but Reason (R) is true.
Solution hidden
Log in to view solution →
Q18
short answer
2 marks
Explain how the immunity of a person is affected if there is atrophy (degeneration) of the thymus gland at an early stage of life.
Solution hidden
Log in to view solution →
Q18
short answer
2 marks
Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames. Frame 1: $5'\ \mathrm{CUCGCUUGCCGAUCAAGGGUUA}\ 3'$ Frame 2: $5'\ \mathrm{GUGGCACUCAGUCCUUAAUGGCG}\ 3'$ Answer the following question: How many amino acids will be specified in case (a) and case (b) on translation? Justify your answer.
Solution hidden
Log in to view solution →
Q19
short answer
2 marks
What are interferons? Explain their role in providing immunity to a person.
Solution hidden
Log in to view solution →
Q19
short answer
2 marks
(a) Explain what is meant by the term MTP. What was the main reason to legalize MTP by the Government of India? OR (b) Name any two STIs which might occur in a human female. State its two early symptoms.
Solution hidden
Log in to view solution →
Q20
short answer
2 marks
Which category of innate immunity defence barrier can interferons be classified into?
Solution hidden
Log in to view solution →
Q20
short answer
2 marks
The basic scheme of the essential steps involved in the process of recombinant DNA technology is summarized below in the form of a flow diagram. Study the given flow diagram and answer the questions that follow. (a) Name the enzyme used in Step-1 to join the cut plasmid and alien DNA. (b) State the technical term used for Step-3. (c) Justify the use of same Restriction Enzyme EcoR I to cut both the vector DNA and the alien DNA.
Solution hidden
Log in to view solution →
Q21
short answer
2 marks
(a) Explain how the interaction between sea anemone and clownfish is one of the best examples of commensalism in nature. OR (b) Correctly depict (also indicate the trophic level) and describe the ecological pyramid of biomass in sea with 40 standing crop of phytoplankton supporting 90 standing crop of zooplankton which further supports 120 small fishes.
Solution hidden
Log in to view solution →
Q22
short answer
3 marks
Explain the process of formation of placenta in a human female after the implantation of the blastocyst in the endometrium of the uterus.
Solution hidden
Log in to view solution →
Q23
short answer
3 marks
Gregor Mendel conducted hybridisation experiments in garden pea for seven years and proposed the law of inheritance. (a) Why was he successful in his hybridisation experiments? Give two reasons. (b) State the law of independent assortment as proposed by Mendel after his dihybrid crosses.
Solution hidden
Log in to view solution →
Q24
short answer
3 marks
Study the given below single strand of deoxyribonucleic acid depicted in $3'$ end directionality, sugars as vertical lines and bases as single letter abbreviations and answer the questions that follow. (a) Name the covalent bonds depicted as (a) and (b) in the form of slanting lines in the diagram. (b) (c) Draw the chemical structure of the given polynucleotide chain of DNA.
Solution hidden
Log in to view solution →
Q25
short answer
3 marks
Explain the biological treatment of primary effluent when passed into the large aeration tanks in a sewage treatment plant (STP).
Solution hidden
Log in to view solution →
Q26
short answer
3 marks
Given below is a flower with its characteristic features specialised for the most common type of abiotic pollination.
Answer the following questions based on the above diagram:
(a) Name the mode of abiotic pollination that will be adopted by the given plant species in the above picture.
(b) State the need of exposed large feathery stigmas for the flower.
(c) What will be the two important adaptations in the pollen grains of the flowers pollinated by the above mode of pollination?
(d) What could be the probable reason for the petals being small and non-green?
Solution hidden
Log in to view solution →
Q27
short answer
3 marks
survival in Mudumalai Tiger Reserve (MTR) was found to be a small, beautiful flower, Lantana camara, a tropical American shrub, that Lantana weed eradication drive helped to restore the dying MTR thereby also reducing human-wildlife conflicts. MTR is home to 25 species of grasses and legumes.
Answer the given questions based on the information given above.
(a) Explain how did the removal of Lantana help in restoring the dying Mudumalai Tiger Reserve.
(b) Why is the invasion of Lantana camara a cause of concern in MTR.
Solution hidden
Log in to view solution →
Q28
short answer
3 marks
Enlist one advantage and two disadvantages of green revolution.
Solution hidden
Log in to view solution →
Q29
short answer
3 marks
Gregor Mendel conducted hybridisation experiments in garden pea for seven years and proposed the law of inheritance.
(a) Why was he successful in his hybridisation experiments? Give two reasons.
Solution hidden
Log in to view solution →
Q30
short answer
3 marks
State the law of independent assortment as proposed by Mendel after his dihybrid crosses.
Solution hidden
Log in to view solution →Reading Passage
Deaths related to the use of drugs were estimated at about 5,00,000 in 2019, 175 percent more than in 2009. Liver diseases attributed to Hepatitis B are a major cause of drug-related deaths, according to UNODC, accounting for more than half of the total number of deaths attributed to the use of drugs. Drug overdoses account for a quarter of drug-related deaths. Opioids contribute to account for the most severe drug-related harm, including fatal overdoses, when used non-medically. At the global level, two-third of direct drug-related deaths are due to opioids, and in some sub-regions the proportion can be as high as three-quarters of such deaths.
Q30
short answer
1 mark
Why are people taking opioids more prone to liver diseases attributed to Hepatitis B ?
Solution hidden
Log in to view solution →
Q31
long answer
5 marks
(a) (i) Explain how does double fertilisation take place in a flowering plant.
(ii) Write the fate of the products of double fertilization in these plants.
Solution hidden
Log in to view solution →
Q31
long answer
5 marks
(b) (i) Explain the structure of testicular lobules in human male reproductive system. Name the two types of cells present in the seminiferous tubules and state their role.
(ii) Describe the role of hypothalamic hormone GnRH in spermatogenesis.
Solution hidden
Log in to view solution →
Q32
long answer
5 marks
Name and explain the biotechnological strategy wherein the infection by the nematode Meloidegyne incognitia can be prevented using Agrobacterium vectors in the roots of tobacco plant by RNA interference.
Solution hidden
Log in to view solution →
Q32
long answer
5 marks
Explain the amplification of gene of interest using the technique of Polymerase chain reaction (PCR).
Solution hidden
Log in to view solution →
Q33
long answer
5 marks
(a) (i) Describe the population growth curve applicable in a population of any species in nature that has limited resources at its disposal.
(ii) Give the equation of this growth curve.
(iii) Name the growth curve and depict a graphical plot for this type of population growth.
Solution hidden
Log in to view solution →
Q33
long answer
5 marks
(b) (i) Explain the Species-Area relationship within a natural forest and also predict the nature of graph when species richness is plotted against the area for a wide variety of taxa.
(ii) Depict the graphical relationship between species richness and area.
(iii) Give the equation of the Species-Area relationship for a wide variety of taxa on a logarithmic scale.
Solution hidden
Log in to view solution →Reading Passage
The most convincing evidence to trace evolutionary relationships between humans and different groups of animals come from the basic similarities seen at the molecular level. Study the table given below that depicts the number of amino acid differences between the haemoglobin polypeptide of few animals with that of humans and answer the questions that follow. S.No. Animal No. of amino acid differences in haemoglobin with that of humans 1. Macaque 08 2. Dog 32 3. Bird 45 4. Frog 67 5. Lamprey 125
Q34
short answer
4 marks
Read the following passage and answer the questions that follow.
The most convincing evidence to trace evolutionary relationships between humans and different groups of animals come from the basic similarities seen at the molecular level. Study the table given below that depicts the number of amino acid differences between the haemoglobin polypeptide of few animals with that of humans and answer the questions that follow.
S.No. Animal No. of amino acid differences in haemoglobin with that of humans
1. Macaque 08
2. Dog 32
3. Bird 45
4. Frog 67
5. Lamprey 125
(a) To which category of evolution (Divergent or Convergent) do the following evolutionary relationships belong to:
(i) Humans and Macaque
Solution hidden
Log in to view solution →
Q35
short answer
4 marks
To which category of evolution (Divergent or Convergent) do the following evolutionary relationships belong to:
(ii) Humans and Frog
Solution hidden
Log in to view solution →
Q36
short answer
1 mark
What do the biochemical similarities in haemoglobin suggest about the evolutionary relationship between humans, frog and lamprey ?
Solution hidden
Log in to view solution →
Q37
short answer
2 marks
Which one of the two is closely related to humans and why ?
Solution hidden
Log in to view solution →Reading Passage
Deaths related to the use of drugs were estimated at about 5,00,000 in 2019, 175 percent more than in 2009. Liver diseases attributed to Hepatitis B are a major cause of drug-related deaths, according to UNODC, accounting for more than half of the total number of deaths attributed to the use of drugs. Drug overdoses account for a quarter of drug-related deaths. Opioids contribute to account for the most severe drug-related harm, including fatal overdoses, when used non-medically. At the global level, two-third of direct drug-related deaths are due to opioids, and in some sub-regions the proportion can be as high as three-quarters of such deaths.
Q39
short answer
1 mark
What is meant by direct drug-related disease ?
Solution hidden
Log in to view solution →
Q40
short answer
2 marks
What is the scientific name of the plant from which the opioids are derived and from which part of the plant is it extracted ?
Solution hidden
Log in to view solution →
Q41
short answer
2 marks
State two common warning signs of drug abuse among the youth.
Solution hidden
Log in to view solution →