Empowering Students with AI-Powered Assessments & Intelligent Learning
Tamil Nadu State Board · CLASS 12th · Zoology

TAMIL NADU STATE BOARD CLASS 12 ZOOLOGY 2025

30 questions from this CLASS 12th Zoology paper. Log in as a CLASS 12th student to view solutions.

🔒 Login / Register to Download PDF
Q1 mcq 1 mark
A person is injured and got swelling. The swelling, due to the infection of tissue is an example of:
  • A. Phagocytosis
  • B. Mechanical barrier
  • C. Inflammation
  • D. Physiological barrier

Solution hidden

Log in to view solution →
Q2 mcq 1 mark
The first codon to be deciphered was ____________ which codes for __________.
  • A. UUU, Phenylalanine
  • B. AAA, Proline
  • C. TTT, Arginine
  • D. GGG, Alanine

Solution hidden

Log in to view solution →
Q3 mcq 1 mark
Find out the wrongly matched pair.
  • A. Klinefelter’s Syndrome - XXY Female
  • B. Down’s Syndrome - Trisomy-21
  • C. Turner’s Syndrome - XO Female
  • D. Patau’s Syndrome - Trisomy-13

Solution hidden

Log in to view solution →
Q4 mcq 1 mark
The Neanderthal man had the brain capacity of:
  • A. 900 cc
  • B. 650-800 cc
  • C. 1400 cc
  • D. 1200 cc

Solution hidden

Log in to view solution →
Q5 mcq 1 mark
Which one of the following groups includes sexually transmitted diseases caused by bacteria only?
  • A. Syphilis, gonorrhoea and trichomoniasis
  • B. Syphilis, gonorrhoea and candidiasis
  • C. Syphilis, trichomoniasis and pediculosis
  • D. Syphilis, chlamydiasis and gonorrhoea

Solution hidden

Log in to view solution →
Q6 mcq 1 mark
ELISA is mainly used for:
  • A. Selecting animals having desired traits
  • B. Detection of mutations
  • C. Selecting plants having desired traits
  • D. Detection of pathogens

Solution hidden

Log in to view solution →
Q7 mcq 1 mark
The most important hormone in initiating and maintaining lactation after birth is:
  • A. Prolactin
  • B. Oestrogen
  • C. Oxytocin
  • D. FSH

Solution hidden

Log in to view solution →
Q8 mcq 1 mark
Assertion: The environmental conditions of the Tropics are favourable for speciation and diversity of organisms. Reason: The climate seasons, temperature, humidity and photoperiod are more or less stable and congenial.
  • A. Assertion is true, but Reason is false.
  • B. Both Assertion and Reason are true and Reason explains Assertion correctly.
  • C. Both Assertion and Reason are false.
  • D. Both Assertion and Reason are true but Reason is not the correct explanation of Assertion.

Solution hidden

Log in to view solution →
Q9 mcq 1 mark
The figure given below is a diagrammatic representation of response of organisms to abiotic factors. What do A, B and C represent respectively?
  • A. Partial Regulator, Regulator, Conformer
  • B. Conformer, Regulator, Partial Regulator
  • C. Regulator, Conformer, Partial Regulator
  • D. Regulator, Partial Regulator, Conformer

Solution hidden

Log in to view solution →
Q10 mcq 1 mark
The mode of sexual reproduction in bacteria is by:
  • A. Conjugation
  • B. Formation of gametes
  • C. Zoospore formation
  • D. Endospore formation

Solution hidden

Log in to view solution →
Q11 mcq
The headquarters of the National Biodiversity Authority is situated in __________.
  • A. Delhi
  • B. Mumbai
  • C. Kolkata
  • D. Chennai

Solution hidden

Log in to view solution →
Q12 mcq
The clusters of gene with related functions are called as _________.
  • A. Recons
  • B. Mutons
  • C. Operons
  • D. Cistrons

Solution hidden

Log in to view solution →
Q13 mcq
Which of the following micro-organisms is used for production of citric acid in Industries ?
  • A. Aspergillus niger
  • B. Lactobacillus bulgaris
  • C. Rhizopus nigricans
  • D. Penicillium citrinum

Solution hidden

Log in to view solution →
Q14 mcq
The ‘thickness’ of Stratospheric Ozone layer is measured in :
  • A. Melson units
  • B. Sieverts units
  • C. Beaufort scale
  • D. Dobson units

Solution hidden

Log in to view solution →
Q15 mcq
Haemozoin is :
  • A. A toxin from Plasmodium species
  • B. A precursor of haemoglobin
  • C. A toxin from Haemophilus species
  • D. A toxin from Streptococcus

Solution hidden

Log in to view solution →
Q16 short answer
What is ectopic pregnancy ?

Solution hidden

Log in to view solution →
Q17 short answer
Draw and mention the parts of a spermatozoan.

Solution hidden

Log in to view solution →
Q18 short answer
Give any two applications of DNA finger printing.

Solution hidden

Log in to view solution →
Q19 short answer
List out the major gases seems to be found in the primitive earth.

Solution hidden

Log in to view solution →
Q20 short answer
Rearrange the descent in human evolution. Australopithecus → Homo erectus → Homo sapiens → Ramapithecus → Homo habilis

Solution hidden

Log in to view solution →
Q21 short answer
How does Saliva act in body defence ?

Solution hidden

Log in to view solution →
Q22 short answer
Give any two bioactive molecules produced by microbes and state their uses.

Solution hidden

Log in to view solution →
Q23 short answer
What is Acclimatisation ?

Solution hidden

Log in to view solution →
Q24 short answer
Differentiate Natality and Mortality.

Solution hidden

Log in to view solution →
Q25 short answer
Differentiate Fission and Fragmentation with suitable examples.

Solution hidden

Log in to view solution →
Q26 short answer
Give the expansion for the following. (1)Z I F T (2)I C S I (3)I U T

Solution hidden

Log in to view solution →
Q27 short answer
What is criss-cross inheritance ? Give example.

Solution hidden

Log in to view solution →
Q28 short answer
If the coding sequence in a transcription unit is written as follows : $5'$ TGCATGCATGCATGCATGCATGCATGC $3'$ Write down the nucleotide sequence of mRNA.

Solution hidden

Log in to view solution →
Q29 short answer
Complete the following table. Diseases Causative agent Site of infections Mumps Chicken pox Dengue fever

Solution hidden

Log in to view solution →
Q30 short answer
What is bioremediation ? Mention their types.

Solution hidden

Log in to view solution →