Q1
mcq
1 mark
The nucleosome core is composed of:
- A. Histones and linker DNA
- B. Histones and about 200 bp of DNA
- C. NHC proteins and linker DNA
- D. NHC proteins and about 200 bp of DNA
Solution hidden
Log in to view solution →
Q2
mcq
1 mark
Given below are few statements with respect to the process of oogenesis in a human ovary:
(i) Each granulosa cell gets surrounded by a primary oocyte to form the primary follicle.
(ii) A couple of million of oogonia are formed within each fetal ovary during the embryonic development.
(iii) Tertiary follicle is characterised by antrum and theca layers.
(iv) Secondary follicles form a zona pellucida layer around it.
(v) Mature graafian follicle ruptures to release the secondary oocyte from the ovary.
Choose the option with all true statements from the given options:
- A. (i), (ii), (iv)
- B. (ii), (iii), (v)
- C. (ii), (iv), (v)
- D. (i), (iii), (iv)
Solution hidden
Log in to view solution →
Q3
mcq
1 mark
The simplest definition of a gene in eukaryotes is a unit of DNA that has information to mainly specify the synthesis of:
- A. Single polypeptide chain and mRNA only
- B. Many polypeptide chains and mRNA only
- C. Single polypeptide chain and functional RNA only
- D. Many polypeptide chains and functional RNA only
Solution hidden
Log in to view solution →
Q4
mcq
1 mark
A colourblind man marries a woman with normal sight who has no history of colourblindness in her family. What is the probability of their son being colourblind?
- A. 0.5
- B. 1
- C. Nil
- D. 0.25
Solution hidden
Log in to view solution →
Q5
mcq
1 mark
The type of antibodies produced during an immune response to allergens as dust and pollen grains in a person is:
- A. IgE
- B. IgA
- C. IgG
- D. IgD
Solution hidden
Log in to view solution →
Q6
mcq
1 mark
Select the statements that are true for a typical megasporangium of flowering plants.
(i) It is attached to the placenta by hilum.
(ii) It has a chalaza end that represents the basal part of the ovule.
(iii) It has
- A. (i) (ii)
- B. (ii) (iii)
- C. (iii) (iv)
- D. (i) (iv)
Solution hidden
Log in to view solution →
Q6
mcq
Select the statements that are true for a typical megasporangium of flowering plants.
(i) It is attached to the placenta by hilum.
(ii) It has a chalaza end that represents the basal part of the ovule.
(iii) It has nucellus enclosed by integuments.
(iv) Its micropylar end is known as chalaza.
Choose the correct answer:
- A. (i) and (ii)
- B. (ii) and (iii)
- C. (iii) and (iv)
- D. (i) and (iv)
Solution hidden
Log in to view solution →
Q7
mcq
The primates that probably lived in East Africa grasslands about two mya were:
- A. Dryopithecus
- B. Ramapithecus
- C. Australopithecines
- D. Neanderthal
Solution hidden
Log in to view solution →
Q8
mcq
1 mark
The anticodon of tRNA3 is:
- A. UAU
- B. AUG
- C. AUA
- D. AGU
Solution hidden
Log in to view solution →
Q8
mcq
Use the given information to select the amino acid attached to the 3' end of tRNA during the process of translation, if the coding strand of the DNA has the following codons for the amino acids:
UAU Tyrosine
AUG Methionine
AUA Isoleucine
AGU Serine
- A. Isoleucine
- B. Methionine
- C. Tyrosine
- D. Serine
Solution hidden
Log in to view solution →
Q9
mcq
Early detection of HIV in suspected AIDS patients can be done using the diagnostic technique of:
- A. ELISA
- B. PCR
- C. EST
- D. RNAi
Solution hidden
Log in to view solution →
Q10
mcq
The correct depiction of the experiment performed by Matthew Meselson and Franklin Stahl to prove that DNA replicates semi-conservatively on separation of DNA by centrifugation after 40 minutes is:
Solution hidden
Log in to view solution →
Q12
mcq
In pea plant (Pisum sativum) axial flower position is dominant over terminal flower position. The expected ratio of phenotypes of the offspring in a cross between both the parents with heterozygous axial flower will be:
- A. 3 : 1
- B. 2 : 1
- C. 1 : 1
- D. 1 : 0
Solution hidden
Log in to view solution →
Q15
short answer
Assertion (A): ABO blood grouping in humans is an example of multiple allelism.
Reason (R): More than two genes in a population govern the same character in ABO blood grouping in humans.
Solution hidden
Log in to view solution →
Q16
short answer
Assertion (A): A person infected with malaria suffers from chill and high fever, recurring every three or four days.
Reason (R): The parasite attacks the RBC resulting in their rupture and release of haemozoin.
Solution hidden
Log in to view solution →
Q17
short answer
2 marks
The basic scheme of the essential steps involved in the process of recombinant DNA technology is summarized below in the form of a flow diagram. Study the given flow diagram and answer the questions that follow.
(a) Name the enzyme used in Step-1 to join the cut plasmid and alien DNA.
(b) State the technical term used for Step-3.
(c) Justify the use of same Restriction Enzyme EcoR I to cut both the vector DNA and the alien DNA.
Solution hidden
Log in to view solution →
Q18
short answer
2 marks
(a) Explain how the interaction between sea anemone and clownfish is one of the best examples of commensalism in nature.
OR
(b) Correctly depict (also indicate the trophic level) and describe the ecological pyramid of biomass in sea with 40 standing crop of phytoplankton supporting 90 standing crop of zooplankton which further supports 120 small fishes.
Solution hidden
Log in to view solution →
Q19
short answer
2 marks
Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames.
(a) Translation starting from the first nucleotide (Reading frame 1)
(b) Translation starting from the second nucleotide (Reading frame 2)
Frame 1
5 CUCGCUUGCCGAUCAAGGGUUA 3
Frame 2
5 GUGGCACUCAGUCCUUAAUGGCG 3
Answer the following question:
How many amino acids will be specified in case (a) and case (b) on translation? Justify your answer.
Solution hidden
Log in to view solution →
Q20
short answer
2 marks
(a) Explain how the immunity of a person is affected if there is atrophy (degeneration) of the thymus gland at an early stage of life.
OR
(b) (i) What are interferons? Explain their role in providing immunity to a person.
(ii) Which category of innate immunity defence barrier can interferons be classified into?
Solution hidden
Log in to view solution →
Q21
short answer
2 marks
(a) Write two features of an ideal contraceptive. Explain any one natural contraceptive method that makes the chances of conception almost nil.
OR
(b) Explain GIFT and ICSI.
Solution hidden
Log in to view solution →
Q22
short answer
3 marks
Explain the biological treatment of primary effluent when passed into the large aeration tanks in a sewage treatment plant (STP).
Solution hidden
Log in to view solution →
Q23
short answer
3 marks
Given below is a flower with its characteristic features specialised for the most common type of abiotic pollination.
Answer the following questions based on the above diagram:
(a) Name the mode of abiotic pollination that will be adopted by the given plant species in the above picture.
(b) State the need of exposed large feathery stigmas for the flower.
(c) What will be the two important adaptations in the pollen grains of the flowers pollinated by the above mode of pollination?
(d) What could be the probable reason for the petals being small and non-green?
Solution hidden
Log in to view solution →
Q24
short answer
3 marks
Enlist one advantage and two disadvantages of green revolution.
Solution hidden
Log in to view solution →
Q25
short answer
3 marks
Study the given below single strand of deoxyribonucleic acid depicted in 3' end directionality, sugars as vertical lines and bases as single letter abbreviations and answer the questions that follow.
(a) Name the covalent bonds depicted as (a) and (b) in the form of slanting lines in the diagram.
(b)
(c) Draw the chemical structure of the given polynucleotide chain of DNA.
Solution hidden
Log in to view solution →
Q26
short answer
Thomas Hunt Morgan carried out several dihybrid crosses in Drosophila melanogaster to study genes that were sex linked.
(a) Give four major reasons for using the tiny fruit flies by Morgan for his experiments.
(b) How did Morgan and his group explain the
Solution hidden
Log in to view solution →
Q26
short answer
3 marks
Thomas Hunt Morgan carried out several dihybrid crosses in Drosophila melanogaster to study genes that were sex linked.
(a) Give four major reasons for using the tiny fruit flies by Morgan for his experiments.
(b) How did Morgan and his group explain the physical association of the two genes on a chromosome to the frequency of recombination between gene pairs on the same chromosome ?
Solution hidden
Log in to view solution →
Q27
short answer
3 marks
Explain the process of formation of placenta in a human female after the implantation of the blastocyst in the endometrium of the uterus.
Solution hidden
Log in to view solution →
Q28
short answer
3 marks
survival in Mudumalai Tiger Reserve (MTR) was found to be a small, beautiful flower, Lantana camara, a tropical American shrub, that Lantana weed eradication drive helped to restore the dying MTR thereby also reducing human-wildlife conflicts. MTR is home to 25 species of grasses and legumes.
Answer the given questions based on the information given above.
(a) Explain how did the removal of Lantana help in restoring the dying Mudumalai Tiger Reserve.
(b) Why is the invasion of Lantana camara a cause of concern in MTR.
Solution hidden
Log in to view solution →Reading Passage
Deaths related to the use of drugs were estimated at about 5,00,000 in 2019, 175 percent more than in 2009. Liver diseases attributed to Hepatitis B are a major cause of drug-related deaths, according to UNODC, accounting for more than half of the total number of deaths attributed to the use of drugs. Drug overdoses account for a quarter of drug-related deaths. Opioids contribute to account for the most severe drug-related harm, including fatal overdoses, when used non-medically. At the global level, two-third of direct drug-related deaths are due to opioids, and in some sub-regions the proportion can be as high as three-quarters of such deaths.
Q29
short answer
4 marks
Read the following passage and answer the questions that follow.
Deaths related to the use of drugs were estimated at about 5,00,000 in 2019, 175 percent more than in 2009. Liver diseases attributed to Hepatitis B are a major cause of drug-related deaths, according to UNODC, accounting for more than half of the total number of deaths attributed to the use of drugs. Drug overdoses account for a quarter of drug-related deaths.
Opioids contribute to account for the most severe drug-related harm, including fatal overdoses, when used non-medically. At the global level, two-third of direct drug-related deaths are due to opioids, and in some sub-regions the proportion can be as high as three-quarters of such deaths.
(a) Why are people taking opioids more prone to liver diseases attributed to Hepatitis B ?
(b) What is meant by direct drug-related disease ?
(c) (i) What is the scientific name of the plant from which the opioids are derived and from which part of the plant is it extracted ?
OR
(c) (ii) State two common warning signs of drug abuse among the youth.
Solution hidden
Log in to view solution →Reading Passage
The most convincing evidence to trace evolutionary relationships between humans and different groups of animals come from the basic similarities seen at the molecular level. Study the table given below that depicts the number of amino acid differences between the haemoglobin polypeptide of few animals with that of humans and answer the questions that follow. S.No. Animal No. of amino acid differences in haemoglobin with that of humans 1. Macaque 08 2. Dog 32 3. Bird 45 4. Frog 67 5. Lamprey 125
Q30
short answer
4 marks
Read the following passage and answer the questions that follow.
The most convincing evidence to trace evolutionary relationships between humans and different groups of animals come from the basic similarities seen at the molecular level. Study the table given below that depicts the number of amino acid differences between the haemoglobin polypeptide of few animals with that of humans and answer the questions that follow.
S.No. Animal No. of amino acid differences in haemoglobin with that of humans
1. Macaque 08
2. Dog 32
3. Bird 45
4. Frog 67
5. Lamprey 125
(a) To which category of evolution (Divergent or Convergent) do the following evolutionary relationships belong to :
(i) Humans and Macaque
(ii) Humans and Frog
(b) What do the biochemical similarities in haemoglobin suggest about the evolutionary relationship between humans, frog and lamprey ?
(c) (i) Which one of the two closely related to humans and why ?
OR
(c) (ii) Which one of the two related to humans and why ?
Solution hidden
Log in to view solution →Reading Passage
The most convincing evidence to trace evolutionary relationships between humans and different groups of animals come from the basic similarities seen at the molecular level. Study the table given below that depicts the number of amino acid differences between the haemoglobin polypeptide of few animals with that of humans and answer the questions that follow. S.No. Animal No. of amino acid differences in haemoglobin with that of humans 1. Macaque 08 2. Dog 32 3. Bird 45 4. Frog 67 5. Lamprey 125
Q31
short answer
1 mark
To which category of evolution (Divergent or Convergent) do the following evolutionary relationships belong to:
(i) Humans and Macaque
(ii) Humans and Frog
Solution hidden
Log in to view solution →
Q32
short answer
1 mark
What do the biochemical similarities in haemoglobin suggest about the evolutionary relationship between humans, frog and lamprey ?
Solution hidden
Log in to view solution →
Q33
short answer
2 marks
Which one of the two is more closely related to humans and why ?
Solution hidden
Log in to view solution →
Q34
long answer
5 marks
Describe the population growth curve applicable in a population of any species in nature that has limited resources at its disposal.
Solution hidden
Log in to view solution →
Q35
short answer
5 marks
Give the equation of this growth curve.
Solution hidden
Log in to view solution →
Q36
long answer
5 marks
Name the growth curve and depict a graphical plot for this type of population growth.
Solution hidden
Log in to view solution →
Q37
long answer
5 marks
Explain the Species-Area relationship within a natural forest and also predict the nature of graph when species richness is plotted against the area for a wide variety of taxa.
Solution hidden
Log in to view solution →
Q38
short answer
5 marks
Depict the graphical relationship between species richness and area.
Solution hidden
Log in to view solution →
Q39
short answer
5 marks
Give the equation of the Species-Area relationship for a wide variety of taxa on a logarithmic scale.
Solution hidden
Log in to view solution →
Q40
long answer
5 marks
Explain how does double fertilisation take place in a flowering plant.
Solution hidden
Log in to view solution →
Q41
short answer
5 marks
Write the fate of the products of double fertilization in these plants.
Solution hidden
Log in to view solution →
Q42
long answer
5 marks
Explain the structure of testicular lobules in human male reproductive system. Name the two types of cells present in the seminiferous tubules and state their role.
Solution hidden
Log in to view solution →
Q43
short answer
5 marks
Describe the role of hypothalamic hormone GnRH in spermatogenesis.
Solution hidden
Log in to view solution →
Q44
short answer
5 marks
Name the two genes encoding for the Bt toxin protein used in biotechnology for the control of cotton bollworms.
Solution hidden
Log in to view solution →
Q45
long answer
5 marks
How does the expression of Bt toxin gene in Bt cotton plant help in providing resistance to cotton bollworms ? Explain.
Solution hidden
Log in to view solution →
Q46
long answer
5 marks
Explain the given methods of introducing the alien DNA in the host cells:
(I) Biolistics
(II) Microinjection
Solution hidden
Log in to view solution →