Empowering Students with AI-Powered Assessments & Intelligent Learning
CBSE(NCERT) · Grade 12 · Biology

CBSE(NCERT) GRADE 12 BIOLOGY 2025 SET4

48 questions from this Grade 12 Biology paper. Log in as a Grade 12 student to view solutions.

🔒 Login / Register to Download PDF
Q2 mcq 1 mark
Given below are few statements with reference to oogenesis in a human female: (i) An unequal division of the primary oocyte forms a large secondary oocyte and a tiny first polar body. (ii) A couple of thousands of oogonia are formed within each fetal ovary during embryonic development. (iii) Primary oocytes start meiosis-I but it gets arrested temporarily at prophase-I during fetal development. (iv) Fertilisation induces the completion of the meiotic division of the secondary oocyte. (v) A primary oocyte on meiosis forms an ovum and a polar body. Choose the option with all true statements from the given options:
  • A. (i), (ii), (iv)
  • B. (ii), (iii), (v)
  • C. (ii), (iv), (v)
  • D. (i), (iii), (iv)

Solution hidden

Log in to view solution →
Q3 mcq 1 mark
Thalassemia and Sickle Cell Anaemia are both caused due to problem in globin molecule synthesis. Select the correct statement:
  • A. Both are due to a quantitative defect in globin chain synthesis.
  • B. Thalassemia is due to less synthesis of globin molecules.
  • C. Sickle cell anaemia is due to a quantitative problem of globin molecules.
  • D. Both are due to qualitative defect in globin chain synthesis.

Solution hidden

Log in to view solution →
Q4 mcq 1 mark
A pedigree chart in shown below for a disease that is autosomal dominant. The genetic make-up of the first generation is:
  • A. AA, Aa
  • B. Aa, aa
  • C. Aa, AA
  • D. Aa, Aa

Solution hidden

Log in to view solution →
Q5 mcq 1 mark
Allergy in humans is a result of release of the following chemicals from the mast cells:
  • A. Histamine and Serotonin
  • B. Adrenaline and Acetylcholine
  • C. Dopamine and Nor-adrenalin
  • D. Endorphins and GABA

Solution hidden

Log in to view solution →
Q6 mcq 1 mark
Select the statements that are true for outbreeding devices in the flowering plants. (i) They discourage cross-pollination and ensure self-pollination.
  • A. (i)
  • B. (ii) (iii)
  • C. (iii) (iv)
  • D. (i) (iv)

Solution hidden

Log in to view solution →
Q6 mcq
Select the statements that are true for outbreeding devices in the flowering plants. (i) They discourage cross-pollination and ensure self-pollination. (ii) They are advantageous as they lead to inbreeding depression. (iii) Self-incompatibility prevents self-pollen from fertilising the ovules. (iv) To prevent self-pollination in some species pollen release and stigma receptivity are not synchronised. Choose the correct answer:
  • A. (i) and (ii)
  • B. (ii) and (iii)
  • C. (iii) and (iv)
  • D. (i) and (iv)

Solution hidden

Log in to view solution →
Q7 mcq
The first human-like homonid evolved during human evolution is supposed to be:
  • A. Neanderthal man
  • B. Homo habilis
  • C. Homo erectus
  • D. Homo sapiens

Solution hidden

Log in to view solution →
Q8 mcq
Use the given information to select the amino acid attached to the 3 end of tRNA during the process of translation, if the coding strand of the DNA has the codon shown below. Codons for the amino acids: AGG Arginine AAG Lysine UCC Serine GGA Glycine
  • A. Arginine
  • B. Lysine
  • C. Serine
  • D. Glycine

Solution hidden

Log in to view solution →
Q9 mcq
The most widely used transgenic animal for testing the safety of vaccine before they are used in humans is:
  • A. Rabbits
  • B. Pigs
  • C. Sheep
  • D. Mice

Solution hidden

Log in to view solution →
Q10 mcq
The correct depiction of the experiment performed by Matthew Meselson and Franklin Stahl to prove that DNA replicates semi-conservatively on separation of DNA by centrifugation after 40 minutes is:

Solution hidden

Log in to view solution →
Q11 mcq
Bioactive molecule statins used for human welfare are derived from:
  • A. Trichoderma polysporum
  • B. Monascus purpureus
  • C. Propionibacterium shermanii
  • D. Aspergillus niger

Solution hidden

Log in to view solution →
Q12 mcq
In a pea plant ($Pisum\ sativum$) green pod colour is dominant over yellow pod colour. The expected ratio of phenotypes of the first generation offspring in a cross between both the parents with heterozygous green pod colour will be:
  • A. 0 : 1
  • B. 1 : 1
  • C. 2 : 1
  • D. 3 : 1

Solution hidden

Log in to view solution →
Q13 short answer
Assertion (A): ABO blood grouping in humans is an example of multiple allelism. Reason (R): More than two genes in a population govern the same character in ABO blood grouping in humans.

Solution hidden

Log in to view solution →
Q14 short answer
Assertion (A): in vitro -free plants from an infected plant. Reason (R): If the plant is infected with a virus, the roots and the stems are free of virus.

Solution hidden

Log in to view solution →
Q15 short answer
Assertion (A): A person infected with malaria suffers from chill and high fever, recurring every three or four days. Reason (R): The parasite attacks the RBC resulting in their rupture and release of haemozoin.

Solution hidden

Log in to view solution →
Q16 short answer
Assertion (A): increases phagocytosis of sperms. Reason (R): It is a non-steroidal preparation.

Solution hidden

Log in to view solution →
Q17 short answer 2 marks
The basic scheme of the essential steps involved in the process of recombinant DNA technology is summarized below in the form of a flow diagram. Study the given flow diagram and answer the questions that follow. (a) Name the enzyme used in Step-1 to join the cut plasmid and alien DNA. (b) State the technical term used for Step-3. (c) Justify the use of same Restriction Enzyme EcoR I to cut both the vector DNA and the alien DNA.

Solution hidden

Log in to view solution →
Q18 short answer 2 marks
(a) Explain how the interaction between sea anemone and clownfish is one of the best examples of commensalism in nature. OR (b) Correctly depict (also indicate the trophic level) and describe the ecological pyramid of biomass in sea with 40 standing crop of phytoplankton supporting 90 standing crop of zooplankton which further supports 120 small fishes.

Solution hidden

Log in to view solution →
Q19 short answer 2 marks
(a) Explain how the immunity of a person is affected if there is atrophy (degeneration) of the thymus gland at an early stage of life. OR (b) (i) What are interferons? Explain their role in providing immunity to a person. (ii) Which category of innate immunity defence barrier can interferons be classified into?

Solution hidden

Log in to view solution →
Q20 short answer 2 marks
Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames. (a) Translation starting from the first nucleotide (Reading frame 1) (b) Translation starting from the second nucleotide (Reading frame 2) Frame 1: $5'\, \text{CUCGCUUGCCGAUCAAGGGUUA}\, 3'$ Frame 2: $5'\, \text{GUGGCACUCAGUCCUUAAUGGCG}\, 3'$ Answer the following question: How many amino acids will be specified in case (a) and case (b) on translation? Justify your answer.

Solution hidden

Log in to view solution →
Q21 short answer 2 marks
(a) (i) Write the function of each of the following: (I) Seminal Plasma (II) Acrosome of human sperm (ii) Differentiate between menarche and menopause. OR (b) (i) How is apomixis different from parthenocarpy? (ii) Why are apples and cashews not called true fruits?

Solution hidden

Log in to view solution →
Reading Passage

survival in Mudumalai Tiger Reserve (MTR) was found to be a small, beautiful flower, Lantana camara, a tropical American shrub, that Lantana weed eradication drive helped to restore the dying MTR thereby also reducing human-wildlife conflicts. MTR is home to 25 species of grasses and legumes.

Q22 short answer 3 marks
survival in Mudumalai Tiger Reserve (MTR) was found to be a small, beautiful flower, Lantana camara, a tropical American shrub, that Lantana weed eradication drive helped to restore the dying MTR thereby also reducing human-wildlife conflicts. MTR is home to 25 species of grasses and legumes. Answer the given questions based on the information given above. (a) Explain how did the removal of Lantana help in restoring the dying Mudumalai Tiger Reserve. (b) Why is the invasion of Lantana camara a cause of concern in MTR.

Solution hidden

Log in to view solution →
Q22 short answer 3 marks
Answer the given questions based on the information given above. (a) Explain how did the removal of Lantana help in restoring the dying Mudumalai Tiger Reserve. (b) Why is the invasion of Lantana camara a cause of concern in MTR.

Solution hidden

Log in to view solution →
Q23 short answer 3 marks
Gregor Mendel used true-breeding pea lines to conduct his hybridisation experiments in garden pea. (a) Explain what is meant by true-breeding pea lines. (b) State the three important points of law of dominance as proposed by Gregor Mendel.

Solution hidden

Log in to view solution →
Q24 short answer 3 marks
Enlist one advantage and two disadvantages of green revolution.

Solution hidden

Log in to view solution →
Q25 short answer 3 marks
Given below is a flower with its characteristic features specialised for the most common type of abiotic pollination. Answer the following questions based on the above diagram: (a) Name the mode of abiotic pollination that will be adopted by the given plant species in the above picture. (b) State the need of exposed large feathery stigmas for the flower. (c) What will be the two important adaptations in the pollen grains of the flowers pollinated by the above mode of pollination? (d) What could be the probable reason for the petals being small and non-green?

Solution hidden

Log in to view solution →
Q26 short answer 3 marks
Explain the process of formation of placenta in a human female after the implantation of the blastocyst in the endometrium of the uterus.

Solution hidden

Log in to view solution →
Q27 short answer 3 marks
Explain the biological treatment of primary effluent when passed into the large aeration tanks in a sewage treatment plant (STP).

Solution hidden

Log in to view solution →
Q28 short answer 3 marks
Study the given below single strand of deoxyribonucleic acid depicted in 3 end directionality, sugars as vertical lines and bases as single letter abbreviations and answer the questions that follow. (a) Name the covalent bonds depicted as (a) and (b) in the form of slanting lines in the diagram. (b) (c) Draw the chemical structure of the given polynucleotide chain of DNA.

Solution hidden

Log in to view solution →
Reading Passage

The most convincing evidence to trace evolutionary relationships between humans and different groups of animals come from the basic similarities seen at the molecular level. Study the table given below that depicts the number of amino acid differences between the haemoglobin polypeptide of few animals with that of humans and answer the questions that follow. S.No. Animal No. of amino acid differences in haemoglobin with that of humans 1. Macaque 08 2. Dog 32 3. Bird 45 4. Frog 67 5. Lamprey 125

Q29 short answer 4 marks
Read the following passage and answer the questions that follow. The most convincing evidence to trace evolutionary relationships between humans and different groups of animals come from the basic similarities seen at the molecular level. Study the table given below that depicts the number of amino acid differences between the haemoglobin polypeptide of few animals with that of humans and answer the questions that follow. S.No. Animal No. of amino acid differences in haemoglobin with that of humans 1. Macaque 08 2. Dog 32 3. Bird 45 4. Frog 67 5. Lamprey 125 (a) To which category of evolution (Divergent or Convergent) do the following evolutionary relationships belong to: (i) Humans and Macaque (ii) Humans and Frog (b) What do the biochemical similarities in haemoglobin suggest about the evolutionary relationship between humans, frog and lamprey? (c) (i) Which one of the two closely related to humans and why ? OR (c) (ii) Which one of the two related to humans and why ?

Solution hidden

Log in to view solution →
Reading Passage

Deaths related to the use of drugs were estimated at about 5,00,000 in 2019, 175 percent more than in 2009. Liver diseases attributed to Hepatitis B are a major cause of drug-related deaths, according to UNODC, accounting for more than half of the total number of deaths attributed to the use of drugs. Drug overdoses account for a quarter of drug-related deaths. Opioids contribute to account for the most severe drug-related harm, including fatal overdoses, when used non-medically. At the global level, two-third of direct drug-related deaths are due to opioids, and in some sub-regions the proportion can be as high as three-quarters of such deaths.

Q30 short answer 4 marks
Read the following passage and answer the questions that follow. Deaths related to the use of drugs were estimated at about 5,00,000 in 2019, 175 percent more than in 2009. Liver diseases attributed to Hepatitis B are a major cause of drug-related deaths, according to UNODC, accounting for more than half of the total number of deaths attributed to the use of drugs. Drug overdoses account for a quarter of drug-related deaths. Opioids contribute to account for the most severe drug-related harm, including fatal overdoses, when used non-medically. At the global level, two-third of direct drug-related deaths are due to opioids, and in some sub-regions the proportion can be as high as three-quarters of such deaths. (a) Why are people taking opioids more prone to liver diseases attributed to Hepatitis B ? (b) What is meant by direct drug-related disease ? (c) (i) What is the scie

Solution hidden

Log in to view solution →
Reading Passage

Deaths related to the use of drugs were estimated at about 5,00,000 in 2019, 175 percent more than in 2009. Liver diseases attributed to Hepatitis B are a major cause of drug-related deaths, according to UNODC, accounting for more than half of the total number of deaths attributed to the use of drugs. Drug overdoses account for a quarter of drug-related deaths. Opioids contribute to account for the most severe drug-related harm, including fatal overdoses, when used non-medically. At the global level, two-third of direct drug-related deaths are due to opioids, and in some sub-regions the proportion can be as high as three-quarters of such deaths.

Q32 short answer 1 mark
Why are people taking opioids more prone to liver diseases attributed to Hepatitis B ?

Solution hidden

Log in to view solution →
Q33 short answer 1 mark
What is meant by direct drug-related disease ?

Solution hidden

Log in to view solution →
Q34 short answer 2 marks
What is the scientific name of the plant from which the opioids are derived and from which part of the plant is it extracted ?

Solution hidden

Log in to view solution →
Q35 short answer 2 marks
State two common warning signs of drug abuse among the youth.

Solution hidden

Log in to view solution →
Q36 short answer
ELISA test is based.

Solution hidden

Log in to view solution →
Q37 long answer 5 marks
Describe all the methods used to treat or cure Adenosine deaminase deficiency in humans.

Solution hidden

Log in to view solution →
Q38 long answer 5 marks
Explain the process of separation and isolation of DNA fragments by a typical gel electrophoresis.

Solution hidden

Log in to view solution →
Q39 long answer 5 marks
Describe the population growth curve applicable in a population of any species in nature that has limited resources at its disposal.

Solution hidden

Log in to view solution →
Q40 short answer 5 marks
Give the equation of this growth curve.

Solution hidden

Log in to view solution →
Q41 short answer 5 marks
Name the growth curve and depict a graphical plot for this type of population growth.

Solution hidden

Log in to view solution →
Q42 long answer 5 marks
Explain the Species-Area relationship within a natural forest and also predict the nature of graph when species richness is plotted against the area for a wide variety of taxa.

Solution hidden

Log in to view solution →
Q43 short answer 5 marks
Depict the graphical relationship between species richness and area.

Solution hidden

Log in to view solution →
Q44 short answer 5 marks
Give the equation of the Species-Area relationship for a wide variety of taxa on a logarithmic scale.

Solution hidden

Log in to view solution →
Q45 long answer 5 marks
Explain how does double fertilisation take place in a flowering plant.

Solution hidden

Log in to view solution →
Q46 short answer 5 marks
Write the fate of the products of double fertilization in these plants.

Solution hidden

Log in to view solution →
Q47 long answer 5 marks
Explain the structure of testicular lobules in human male reproductive system. Name the two types of cells present in the seminiferous tubules and state their role.

Solution hidden

Log in to view solution →
Q48 short answer 5 marks
Describe the role of hypothalamic hormone GnRH in spermatogenesis.

Solution hidden

Log in to view solution →