Q1
PHYSICS
Unit 11: Electrostatics
If $\oint_S \vec{E} \cdot d\vec{S} = 0$ over a surface, then:
↻ Repeated question — also appeared in
2023 (9 sets)
- A. the magnitude of electric field on the surface is constant.
- B. all the charges must necessarily be inside the surface.
- C. the electric field inside the surface is necessarily uniform.
- D. the number of flux lines entering the surface must be equal to the number of flux lines leaving it.
Correct answer & explanation hidden
Log in to view solution →
Q1
PHYSICS
Unit 11: Electrostatics
If $\oint_S \vec{E} \cdot d\vec{S} = 0$ over a surface, then :
↻ Repeated question — also appeared in
2023 (9 sets)
- A. the magnitude of electric field on the surface is constant.
- B. all the charges must necessarily be inside the surface.
- C. the electric field inside the surface is necessarily uniform.
- D. the number of flux lines entering the surface must be equal to the number of flux lines leaving it.
Correct answer & explanation hidden
Log in to view solution →
Q2
PHYSICS
Unit 1: Physics and Measurement
The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Personal errors
- B. Least count errors
- C. Random errors
- D. Instrumental errors
Correct answer & explanation hidden
Log in to view solution →
Q2
PHYSICS
Unit 1: Physics and Measurement
The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Personal errors
- B. Least count errors
- C. Random errors
- D. Instrumental errors
Correct answer & explanation hidden
Log in to view solution →
Q3
PHYSICS
Unit 2: Kinematics
A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. along northward
- B. along north-east
- C. along south-west
- D. along eastward
Correct answer & explanation hidden
Log in to view solution →
Q3
PHYSICS
Unit 2: Kinematics
A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :
↻ Repeated question — also appeared in
2023 (5 sets)
- A. along northward
- B. along north-east
- C. along south-east
- D. along eastward
Correct answer & explanation hidden
Log in to view solution →
Q4
PHYSICS
Unit 1: Physics and Measurement
A metal wire has mass $(0.4 \pm 0.002)$ g, radius $(0.3 \pm 0.001)$ mm and length $(5 \pm 0.02)$ cm. The maximum possible percentage error in the measurement of density will nearly be:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 1.3%
- B. 1.6%
- C. 1.4%
- D. 1.2%
Correct answer & explanation hidden
Log in to view solution →
Q4
PHYSICS
Unit 1: Physics and Measurement
A metal wire has mass $(0.4 \pm 0.002)$ g, radius $(0.3 \pm 0.001)$ mm and length $(5 \pm 0.02)$ cm. The maximum possible percentage error in the measurement of density will nearly be:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 1.3%
- B. 1.6%
- C. 1.4%
- D. 1.2%
Correct answer & explanation hidden
Log in to view solution →
Q5
PHYSICS
Unit 13: Magnetic Effects of Current and Magnetism
The net magnetic flux through any closed surface is:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Positive
- B. Infinity
- C. Negative
- D. Zero
Correct answer & explanation hidden
Log in to view solution →
Q5
PHYSICS
Unit 13: Magnetic Effects of Current and Magnetism
The net magnetic flux through any closed surface is :
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Positive
- B. Infinity
- C. Negative
- D. Zero
Correct answer & explanation hidden
Log in to view solution →
Q6
PHYSICS
Unit 14: Electromagnetic Induction and Alternating Currents
In a series $LCR$ circuit, the inductance $L$ is $10$ mH, capacitance $C$ is $1$ $\mu$F and resistance $R$ is $100$ $\Omega$. The frequency at which resonance occurs is:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 15.9 kHz
- B. 1.59 rad/s
- C. 1.59 kHz
- D. 15.9 rad/s
Correct answer & explanation hidden
Log in to view solution →
Q6
PHYSICS
Unit 14: Electromagnetic Induction and Alternating Currents
In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 $\mu F$ and resistance R is 100 $\Omega$. The frequency at which resonance occurs is :
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 15.9 kHz
- B. 1.59 rad/s
- C. 1.59 kHz
- D. 15.9 rad/s
Correct answer & explanation hidden
Log in to view solution →
Q7
PHYSICS
Unit 12: Current Electricity
The magnitude and direction of the current in the following circuit is
↻ Repeated question — also appeared in
2023 (4 sets)
- A. 0.5 A from A to B through E
- B. 5/9 A from A to B through E
- C. 1.5 A from B to A through E
- D. 0.2 A from B to A through E
Correct answer & explanation hidden
Log in to view solution →
Q8
PHYSICS
Unit 11: Electrostatics
The equivalent capacitance of the system shown in the following circuit is:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. 3 $\mu$F
- B. 6 $\mu$F
- C. 9 $\mu$F
- D. 2 $\mu$F
Correct answer & explanation hidden
Log in to view solution →
Q9
PHYSICS
Unit 13: Magnetic Effects of Current and Magnetism
The magnetic energy stored in an inductor of inductance $4$ $\mu$H carrying a current of $2$ A is:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 4 mJ
- B. 8 mJ
- C. 8 $\mu$J
- D. 4 $\mu$J
Correct answer & explanation hidden
Log in to view solution →
Q9
PHYSICS
Unit 13: Magnetic Effects of Current and Magnetism
The magnetic energy stored in an inductor of inductance 4 $\mu H$ carrying a current of 2 A is :
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 4 mJ
- B. 8 mJ
- C. 8 $\mu J$
- D. 4 $\mu J$
Correct answer & explanation hidden
Log in to view solution →
Q10
PHYSICS
Unit 7: Properties of Solids and Liquids
The venturi-meter works on:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Bernoulli's principle
- B. The principle of parallel axes
- C. The principle of perpendicular axes
- D. Huygen's principle
Correct answer & explanation hidden
Log in to view solution →
Q11
PHYSICS
Unit 18: Atoms and Nuclei
The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to (1/16)th of its initial value?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 40 minutes
- B. 60 minutes
- C. 80 minutes
- D. 20 minutes
Correct answer & explanation hidden
Log in to view solution →
Q13
PHYSICS
Unit 14: Electromagnetic Induction and Alternating Currents
A 12 V, 60 W lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 2.7 A
- B. 3.7 A
- C. 0.37 A
- D. 0.27 A
Correct answer & explanation hidden
Log in to view solution →
Q14
PHYSICS
Unit 9: Kinetic Theory of Gases
The temperature of a gas is -50° C. To what temperature the gas should be heated so that the rms speed is increased by 3 times?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 3295° C
- B. 3097 K
- C. 223 K
- D. 669° C
Correct answer & explanation hidden
Log in to view solution →
Q16
PHYSICS
Unit 7: Properties of Solids and Liquids
The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly : (surface tension of soap solution = 0.03 $N m^{-1}$)
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 5.06x10^-4 J
- B. 3.01x10^-4 J
- C. 50.1x10^-4 J
- D. 30.16x10^-4 J
Correct answer & explanation hidden
Log in to view solution →
Q17
PHYSICS
Unit 18: Atoms and Nuclei
In hydrogen spectrum, the shortest wavelength in the Balmer series is $\lambda$. The shortest wavelength in the Bracket series is :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. 4\lambda
- B. 9\lambda
- C. 16\lambda
- D. 2\lambda
Correct answer & explanation hidden
Log in to view solution →
Q18
PHYSICS
Unit 7: Properties of Solids and Liquids
Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is :
↻ Repeated question — also appeared in
2023 (9 sets)
- A. W/A
- B. W/2A
- C. Zero
- D. 2W/A
Correct answer & explanation hidden
Log in to view solution →
Q18
PHYSICS
Unit 7: Properties of Solids and Liquids
Let a wire be suspended from the ceiling (rigid support) and stretched by a weight $W$ attached at its free end. The longitudinal stress at any point of cross-sectional area $A$ of the wire is :
↻ Repeated question — also appeared in
2023 (9 sets)
- A. $W/A$
- B. $W/2A$
- C. Zero
- D. $2W/A$
Correct answer & explanation hidden
Log in to view solution →
Q19
PHYSICS
Unit 5: Rotational Motion
The angular acceleration of a body, moving along the circumference of a circle, is :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. along the radius towards the centre
- B. along the tangent to its position
- C. along the axis of rotation
- D. along the radius, away from centre
Correct answer & explanation hidden
Log in to view solution →
Q20
PHYSICS
Unit 6: Gravitation
Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be (G = gravitational constant) :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. -12Gm/R
- B. -16Gm/R
- C. -20Gm/R
- D. -8Gm/R
Correct answer & explanation hidden
Log in to view solution →
Q21
PHYSICS
Unit 19: Electronic Devices
A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. p-n junction diodes
- B. Capacitor
- C. Load resistance
- D. A centre-tapped transformer
Correct answer & explanation hidden
Log in to view solution →
Q23
PHYSICS
Unit 8: Thermodynamics
A Carnot engine has an efficiency of 50% when its source is at a temperature $327^{\circ} \text{C}$. The temperature of the sink is :
↻ Repeated question — also appeared in
2023 (8 sets)
- A. $15^{\circ} \text{C}$
- B. $100^{\circ} \text{C}$
- C. $200^{\circ} \text{C}$
- D. $27^{\circ} \text{C}$
Correct answer & explanation hidden
Log in to view solution →
Q24
PHYSICS
Unit 15: Electromagnetic Waves
In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of $2.0 \times 10^{10} \text{ Hz}$ and amplitude $48 \text{ Vm}^{-1}$. Then the amplitude of oscillating magnetic field is : (Speed of light in free space = $3 \times 10^8 \text{ m s}^{-1}$)
↻ Repeated question — also appeared in
2023 (8 sets)
- A. $1.6 \times 10^{-8} \text{ T}$
- B. $1.6 \times 10^{-7} \text{ T}$
- C. $1.6 \times 10^{-6} \text{ T}$
- D. $1.6 \times 10^{-9} \text{ T}$
Correct answer & explanation hidden
Log in to view solution →
Q29
PHYSICS
Unit 12: Current Electricity
Resistance of a carbon resistor determined from colour codes is $(22000 \pm 5\%) \Omega$. The colour of third band must be :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Green
- B. Orange
- C. Yellow
- D. Red
Correct answer & explanation hidden
Log in to view solution →
Q30
PHYSICS
Unit 14: Electromagnetic Induction and Alternating Currents
An ac source is connected to a capacitor $C$. Due to decrease in its operating frequency :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. displacement current increases.
- B. displacement current decreases.
- C. capacitive reactance remains constant
- D. capacitive reactance decreases.
Correct answer & explanation hidden
Log in to view solution →
Q30
PHYSICS
Unit 11: Electrostatics
An ac source is connected to a capacitor C. Due to decrease in its operating frequency:
- A. displacement current increases.
- B. displacement current decreases.
- C. capacitive reactance remains constant
- D. capacitive reactance decreases.
Correct answer & explanation hidden
Log in to view solution →
Q31
PHYSICS
Unit 19: Electronic Devices
Given below are two statements:
Statement I: Photovoltaic devices can convert optical radiation into electricity.
Statement II: Zener diode is designed to operate under reverse bias in breakdown region.
In the light of the above statements, choose the most appropriate answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Both Statement I and Statement II are incorrect.
- B. Statement I is correct but Statement II is incorrect.
- C. Statement I is incorrect but Statement II is correct.
- D. Both Statement I and Statement II are correct.
Correct answer & explanation hidden
Log in to view solution →
Q32
PHYSICS
Unit 11: Electrostatics
An electric dipole is placed at an angle of $30^{\circ}$ with an electric field of intensity $2 \times 10^5 \text{ N C}^{-1}$. It experiences a torque equal to $4 \text{ N m}$. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.
↻ Repeated question — also appeared in
2023 (9 sets)
- A. 6 mC
- B. 4 mC
- C. 2 mC
- D. 8 mC
Correct answer & explanation hidden
Log in to view solution →
Q32
PHYSICS
Unit 11: Electrostatics
An electric dipole is placed at an angle of 30° with an electric field of intensity $2 \times 10^5 \text{ N C}^{-1}$. It experiences a torque equal to 4 N m. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.
↻ Repeated question — also appeared in
2023 (9 sets)
- A. 6 mC
- B. 4 mC
- C. 2 mC
- D. 8 mC
Correct answer & explanation hidden
Log in to view solution →
Q33
PHYSICS
Unit 7: Properties of Solids and Liquids
The potential energy of a long spring when stretched by 2 cm is $U$. If the spring is stretched by 8 cm, potential energy stored in it will be :
↻ Repeated question — also appeared in
2023 (1 set)
- A. 4U
- B. 8U
- C. 16U
- D. 2U
Correct answer & explanation hidden
Log in to view solution →
Q33
PHYSICS
Unit 4: Work Energy and Power
The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential energy stored in it will be:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 4U
- B. 8U
- C. 16U
- D. 2U
Correct answer & explanation hidden
Log in to view solution →
Q34
PHYSICS
Unit 16: Optics
Light travels a distance x in time $t_1$ in air and $10x$ in time $t_2$ in another denser medium. What is the critical angle for this medium?
↻ Repeated question — also appeared in
2023 (3 sets)
- A. $\sin^{-1}(\frac{10t_2}{t_1})$
- B. $\sin^{-1}(\frac{t_1}{10t_2})$
- C. $\sin^{-1}(\frac{10t_1}{t_2})$
- D. $\sin^{-1}(\frac{t_2}{t_1})$
Correct answer & explanation hidden
Log in to view solution →
Q36
PHYSICS
Unit 12: Current Electricity
The resistance of platinum wire at 0°C is 2 $\Omega$ and 6.8 $\Omega$ at 80°C. The temperature coefficient of resistance of the wire is:
↻ Repeated question — also appeared in
2023 (4 sets)
- A. $3 \times 10^{-3} \text{ } ^\circ\text{C}^{-1}$
- B. $3 \times 10^{-2} \text{ } ^\circ\text{C}^{-1}$
- C. $3 \times 10^{-1} \text{ } ^\circ\text{C}^{-1}$
- D. $3 \times 10^{-4} \text{ } ^\circ\text{C}^{-1}$
Correct answer & explanation hidden
Log in to view solution →
Q37
PHYSICS
Unit 6: Gravitation
A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G is the universal constant of gravitation, the quantity $\frac{3\pi}{Gd}$ represents:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. $T^2$
- B. $T^3$
- C. $\sqrt{T}$
- D. T
Correct answer & explanation hidden
Log in to view solution →
Q39
PHYSICS
Unit 18: Atoms and Nuclei
The radius of inner most orbit of hydrogen atom is $5.3 \times 10^{-11} \text{ m}$. What is the radius of third allowed orbit of hydrogen atom?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 1.06 Å
- B. 1.59 Å
- C. 4.77 Å
- D. 0.53 Å
Correct answer & explanation hidden
Log in to view solution →
Q40
PHYSICS
Unit 12: Current Electricity
10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased n times. The value of n is:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. 100
- B. 1
- C. 1000
- D. 10
Correct answer & explanation hidden
Log in to view solution →
Q41
PHYSICS
Unit 2: Kinematics
A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity $4 \text{ m s}^{-1}$. The ball strikes the water surface after 4 s. The height of bridge above water surface is (Take $g = 10 \text{ m s}^{-2}$):
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 60 m
- B. 64 m
- C. 68 m
- D. 56 m
Correct answer & explanation hidden
Log in to view solution →
Q42
PHYSICS
Unit 13: Magnetic Effects of Current and Magnetism
A very long conducting wire is bent in a semi-circular shape from A to B as shown in figure. The magnetic field at point P for steady current configuration is given by:
↻ Repeated question — also appeared in
2023 (2 sets)
- A. $\frac{\mu_0 i}{4R}$ pointed away from the page
- B. $\frac{\mu_0 i}{4R} [1 - \frac{2}{\pi}]$ pointed away from page
- C. $\frac{\mu_0 i}{4R} [1 - \frac{2}{\pi}]$ pointed into the page
- D. $\frac{\mu_0 i}{4R}$ pointed into the page
Correct answer & explanation hidden
Log in to view solution →
Q43
PHYSICS
Unit 19: Electronic Devices
For the following logic circuit, the truth table is:
↻ Repeated question — also appeared in
2023 (4 sets)
- A. A=0,B=0,Y=0; A=0,B=1,Y=1; A=1,B=0,Y=1; A=1,B=1,Y=1
- B. A=0,B=0,Y=1; A=0,B=1,Y=0; A=1,B=0,Y=0; A=1,B=1,Y=0
- C. A=0,B=0,Y=0; A=0,B=1,Y=0; A=1,B=0,Y=0; A=1,B=1,Y=1
- D. A=0,B=0,Y=1; A=0,B=1,Y=1; A=1,B=0,Y=1; A=1,B=1,Y=0
Correct answer & explanation hidden
Log in to view solution →
Q44
PHYSICS
Unit 3: Laws of Motion
Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 ($g = 10 \text{ m s}^{-2}$).
↻ Repeated question — also appeared in
2023 (6 sets)
- A. 150 $m s^{-2}$
- B. 1.5 $m s^{-2}$
- C. 50 $m s^{-2}$
- D. 1.2 $m s^{-2}$
Correct answer & explanation hidden
Log in to view solution →
Q45
PHYSICS
Unit 14: Electromagnetic Induction and Alternating Currents
The net impedance of circuit (as shown in figure) will be:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. 15 $\Omega$
- B. $5\sqrt{5}$ $\Omega$
- C. 25 $\Omega$
- D. $10\sqrt{2}$ $\Omega$
Correct answer & explanation hidden
Log in to view solution →
Q45
PHYSICS
Unit 14: Electromagnetic Induction and Alternating Currents
The net impedance of circuit (as shown in figure) will be:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. 15 $\Omega$
- B. 5$\sqrt{5}$ $\Omega$
- C. 25 $\Omega$
- D. 10$\sqrt{2}$ $\Omega$
Correct answer & explanation hidden
Log in to view solution →
Q46
PHYSICS
Unit 16: Optics
In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)?
↻ Repeated question — also appeared in
2023 (4 sets)
- A. -40 cm
- B. -100 cm
- C. -50 cm
- D. 40 cm
Correct answer & explanation hidden
Log in to view solution →
Q47
PHYSICS
Unit 11: Electrostatics
An electric dipole is placed as shown in the figure. The electric potential (in $10^2 \text{ V}$) at point P due to the dipole is ($\epsilon_0$ = permittivity of free space and $\frac{1}{4\pi \epsilon_0} = K$):
↻ Repeated question — also appeared in
2023 (2 sets)
- A. ($\frac{5}{8}$) qK
- B. ($\frac{8}{5}$) qK
- C. ($\frac{8}{3}$) qK
- D. ($\frac{3}{8}$) qK
Correct answer & explanation hidden
Log in to view solution →
Q47
PHYSICS
Unit 11: Electrostatics
The electric potential (in $10^2$ V) at point P due to the dipole is ($\epsilon_0$ = permittivity of free space and $\frac{1}{4\pi\epsilon_0} = K$):
- A. $(\frac{5}{8})qK$
- B. $(\frac{8}{5})qK$
- C. $(\frac{8}{3})qK$
- D. $(\frac{3}{8})qK$
Correct answer & explanation hidden
Log in to view solution →
Q48
PHYSICS
Unit 4: Work Energy and Power
A bullet from a gun is fired on a rectangular wooden block with velocity u. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes u/3. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is:
↻ Repeated question — also appeared in
2023 (4 sets)
- A. 24 cm
- B. 28 cm
- C. 30 cm
- D. 27 cm
Correct answer & explanation hidden
Log in to view solution →
Q48
PHYSICS
Unit 4: Work Energy and Power
A bullet from a gun is fired on a rectangular wooden block with velocity $u$. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes $\frac{u}{3}$. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is:
↻ Repeated question — also appeared in
2023 (4 sets)
- A. 24 cm
- B. 28 cm
- C. 30 cm
- D. 27 cm
Correct answer & explanation hidden
Log in to view solution →
Q49
PHYSICS
Unit 16: Optics
Two thin lenses are of same focal lengths (f), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. f/4
- B. f/2
- C. Infinite
- D. Zero
Correct answer & explanation hidden
Log in to view solution →
Q49
PHYSICS
Unit 16: Optics
Two thin lenses are of same focal lengths ($f$), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. $f/4$
- B. $f/2$
- C. Infinite
- D. Zero
Correct answer & explanation hidden
Log in to view solution →
Q55
CHEMISTRY
Unit 8: Chemical Kinetics
For a certain reaction, the rate = $k[A]^2 [B]$, when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would
↻ Repeated question — also appeared in
2023 (7 sets)
- A. increase by a factor of six.
- B. increase by a factor of nine.
- C. increase by a factor of three.
- D. decrease by a factor of nine.
Correct answer & explanation hidden
Log in to view solution →
Q57
CHEMISTRY
Unit 2: Atomic Structure
A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is $A_x B_y$, then the value of $x + y$ is in option
- A. 4
- B. 3
- C. 2
- D. 5
Correct answer & explanation hidden
Log in to view solution →
Q60
CHEMISTRY
Unit 7: Redox Reactions and Electrochemistry
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: In equation $\Delta_r G = -nFE_{cell}$, value of $\Delta_r G$ depends on n. Reason R: $E_{cell}$ is an intensive property and $\Delta_r G$ is an extensive property.
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Both A and R are true but R is NOT the correct explanation of A.
- B. A is true but R is false.
- C. A is false but R is true.
- D. Both A and R are true and R is the correct explanation of A.
Correct answer & explanation hidden
Log in to view solution →
Q61
CHEMISTRY
Unit 1: Some Basic Concepts in Chemistry
Intermolecular forces are forces of attraction and repulsion between interacting particles that will include: A. dipole-dipole forces. B. dipole-induced dipole forces. C. hydrogen bonding. D. covalent bonding. E. dispersion forces. Choose the most appropriate answer from the options given below:
- A. A, B, C, D are correct.
- B. A, B, C, E are correct.
- C. A, C, D, E are correct.
- D. B, C, D, E are correct.
Correct answer & explanation hidden
Log in to view solution →
Q61
CHEMISTRY
Unit 3: Chemical Bonding and Molecular Structure
Intermolecular forces are forces of attraction and repulsion between interacting particles that will include:
A. dipole-dipole forces.
B. dipole-induced dipole forces.
C. hydrogen bonding.
D. covalent bonding.
E. dispersion forces.
Choose the most appropriate answer from the options given below:
- A. A, B, C, D are correct.
- B. A, B, C, E are correct.
- C. A, C, D, E are correct.
- D. B, C, D, E are correct.
Correct answer & explanation hidden
Log in to view solution →
Q63
CHEMISTRY
Unit 19: Biomolecules
Given below are two statements:
Statement I: A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside.
Statement II: When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. Both Statement I and Statement II are false.
- B. Statement I is true but Statement II is false.
- C. Statement I is false but Statement II is true.
- D. Both Statement I and Statement II are true.
Correct answer & explanation hidden
Log in to view solution →
Q64
CHEMISTRY
Unit 5: Solutions
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: Helium is used to dilute oxygen in diving apparatus.
Reason R: Helium has high solubility in $O_2$.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (3 sets)
- A. Both A and R are true and R is NOT the correct explanation of A.
- B. A is true but R is false.
- C. A is false but R is true.
- D. Both A and R are true and R is the correct explanation of A.
Correct answer & explanation hidden
Log in to view solution →
Q66
BIOLOGY
Unit 8: Biology and Human Welfare
Which amongst the following molecules on polymerization produces neoprene?
- A. H_2C=C(Cl)-CH=CH_2
- B. H_2C=CH-C(CH_3)=CH_2
- C. H_2C=C(CH_3)-CH=CH_2
- D. H_2C=CH-CH=CH_2
Correct answer & explanation hidden
Log in to view solution →
Q69
CHEMISTRY
Unit 11: d- and f-Block Elements
The stability of $Cu^{2+}$ is more than $Cu^+$ salts in aqueous solution due to -
↻ Repeated question — also appeared in
2023 (8 sets)
- A. enthalpy of atomization.
- B. hydration energy.
- C. second ionisation enthalpy.
- D. first ionisation enthalpy.
Correct answer & explanation hidden
Log in to view solution →
Q70
CHEMISTRY
Unit 6: Equilibrium
Amongst the given options which of the following molecules / ion acts as a Lewis acid?
↻ Repeated question — also appeared in
2023 (5 sets)
- A. H_2O
- B. BF_3
- C. OH^-
- D. NH_3
Correct answer & explanation hidden
Log in to view solution →
Q71
CHEMISTRY
Unit 1: Some Basic Concepts in Chemistry
The right option for the mass of $CO_2$ produced by heating 20 g of 20% pure limestone is (Atomic mass of Ca = 40) [$CaCO_3 \xrightarrow{1200 K} CaO + CO_2$]
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 1.76 g
- B. 2.64 g
- C. 1.32 g
- D. 1.12 g
Correct answer & explanation hidden
Log in to view solution →
Q72
CHEMISTRY
Unit 8: Chemical Kinetics
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: A reaction can have zero activation energy.
Reason R: The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Both A and R are true and R is NOT the correct explanation of A.
- B. A is true but R is false.
- C. A is false but R is true.
- D. Both A and R are true and R is the correct explanation of A.
Correct answer & explanation hidden
Log in to view solution →
Q72
CHEMISTRY
Unit 8: Chemical Kinetics
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: A reaction can have zero activation energy.
Reason R: The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Both A and R are true and R is NOT the correct explanation of A.
- B. A is true but R is false.
- C. A is false but R is true.
- D. Both A and R are true and R is the correct explanation of A.
Correct answer & explanation hidden
Log in to view solution →
Q73
CHEMISTRY
Unit 3: Chemical Bonding and Molecular Structure
Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is $NH_3, AlCl_3, BeCl_2, CCl_4, PCl_5$
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 2
- B. 4
- C. 1
- D. 3
Correct answer & explanation hidden
Log in to view solution →
Q73
CHEMISTRY
Unit 3: Chemical Bonding and Molecular Structure
Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is $NH_3, AlCl_3, BeCl_2, CCl_4, PCl_5$.
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 2
- B. 4
- C. 1
- D. 3
Correct answer & explanation hidden
Log in to view solution →
Q75
CHEMISTRY
Unit 2: Atomic Structure
Select the correct statements from the following:
A. Atoms of all elements are composed of two fundamental particles.
B. The mass of the electron is $9.10939 \times 10^{-31}$ kg.
C. All the isotopes of a given element show same chemical properties.
D. Protons and electrons are collectively known as nucleons.
E. Dalton's atomic theory regarded the atom as an ultimate particle of matter.
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (3 sets)
- A. C, D and E only
- B. A and E only
- C. B, C and E only
- D. A, B and C only
Correct answer & explanation hidden
Log in to view solution →
Q76
CHEMISTRY
Unit 8: Chemical Kinetics
Which one is an example of heterogenous catalysis?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Hydrolysis of sugar catalysed by H+ ions.
- B. Decomposition of ozone in presence of nitrogen monoxide.
- C. Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron.
- D. Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen.
Correct answer & explanation hidden
Log in to view solution →
Q81
CHEMISTRY
Unit 14: Some Basic Principles of Organic Chemistry
Which of the following statements are NOT correct?
A. Hydrogen is used to reduce heavy metal oxides to metals.
B. Heavy water is used to study reaction mechanism.
C. Hydrogen is used to make saturated fats from oils.
D. The H-H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element.
E. Hydrogen reduces oxides of metals that are more active than iron.
Choose the most appropriate answer from the options given below:
- A. B, D only
- B. D, E only
- C. A, B, C only
- D. B, C, D, E only
Correct answer & explanation hidden
Log in to view solution →
Q82
CHEMISTRY
Unit 2: Atomic Structure
The relation between $n_m$ ($n_m$ = the number of permissible values of magnetic quantum number ($m$)) for a given value of azimuthal quantum number ($l$), is
↻ Repeated question — also appeared in
2023 (7 sets)
- A. l = 2n_m + 1
- B. n_m = 2l^2 + 1
- C. n_m = l + 2
- D. l = (n_m - 1) / 2
Correct answer & explanation hidden
Log in to view solution →
Q82
CHEMISTRY
Unit 2: Atomic Structure
The relation between $n_m$ ($n_m$ = the number of permissible values of magnetic quantum number ($m$)) for a given value of azimuthal quantum number ($l$), is
↻ Repeated question — also appeared in
2023 (7 sets)
- A. $l = 2n_m + 1$
- B. $n_m = 2l^2 + 1$
- C. $n_m = l + 2$
- D. $l = \frac{n_m - 1}{2}$
Correct answer & explanation hidden
Log in to view solution →
Q83
CHEMISTRY
Unit 13: Purification and Characterisation of Organic Compounds
In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with $Fe^{3+}$ due to the formation of -
↻ Repeated question — also appeared in
2023 (4 sets)
- A. NaSCN
- B. $[Fe(CN)_5NOS]^{4-}$
- C. $[Fe(SCN)]^{2+}$
- D. $Fe_4[Fe(CN)_6]_3 \cdot xH_2O$
Correct answer & explanation hidden
Log in to view solution →
Q85
CHEMISTRY
Unit 10: p-Block Elements
Taking stability as the factor, which one of the following represents correct relationship?
↻ Repeated question — also appeared in
2023 (4 sets)
- A. $InI_3 > InI$
- B. $AlCl > AlCl_3$
- C. $TlI > TlI_3$
- D. $TlCl_3 > TlCl$
Correct answer & explanation hidden
Log in to view solution →
Q86
CHEMISTRY
Unit 17: Organic Compounds Containing Oxygen
Consider the following reaction:
(Diagram: Anisole + $HI$ / $\Delta$ $\rightarrow$ A + B)
Identify products A and B.
- A. A = phenol and B = $CH_3I$
- B. A = $CH_3I$ and B = phenol
- C. A = iodobenzene and B = $CH_3OH$
- D. A = iodobenzene and B = phenol
Correct answer & explanation hidden
Log in to view solution →
Q87
CHEMISTRY
Unit 14: Some Basic Principles of Organic Chemistry
Consider the following compounds/species: (Diagram shows various cyclic structures). The number of compounds/species which obey Huckel's rule is:
- A. 6
- B. 2
- C. 5
- D. 4
Correct answer & explanation hidden
Log in to view solution →
Q89
CHEMISTRY
Unit 11: d- and f-Block Elements
Which of the following statements are INCORRECT?
A. All the transition metals except scandium form MO oxides which are ionic.
B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in $Sc_2O_3$ to $Mn_2O_7$.
C. Basic character increases from $V_2O_3$ to $V_2O_4$ to $V_2O_5$.
D. $V_2O_4$ dissolves in acids to give $VO_2^+$ salts.
E. $CrO$ is basic but $Cr_2O_3$ is amphoteric.
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (2 sets)
- A. B and D only
- B. C and D only
- C. B and C only
- D. A and E only
Correct answer & explanation hidden
Log in to view solution →
Q91
CHEMISTRY
Unit 7: Redox Reactions and Electrochemistry
On balancing the given redox reaction, $aCr_2O_7^{2-}(aq) + bSO_3^{2-}(aq) + cH^+(aq) \rightarrow 2aCr^{3+}(aq) + bSO_4^{2-}(aq) + \frac{c}{2}H_2O(l)$, the coefficients a, b and c are found to be, respectively -
↻ Repeated question — also appeared in
2023 (4 sets)
- A. 3, 8, 1
- B. 1, 8, 3
- C. 8, 1, 3
- D. 1, 3, 8
Correct answer & explanation hidden
Log in to view solution →
Q92
BIOLOGY
Unit 10: Ecology and Environment
Given below are two statements:
Statement I: The nutrient deficient water bodies lead to eutrophication.
Statement II: Eutrophication leads to decrease in the level of oxygen in the water bodies.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Both Statement I and Statement II are false.
- B. Statement I is correct but Statement II is false.
- C. Statement I is incorrect but Statement II is true.
- D. Both Statement I and Statement II are true.
Correct answer & explanation hidden
Log in to view solution →
Q93
PHYSICS
Unit 7: Properties of Solids and Liquids
What fraction of one edge centred octahedral void lies in one unit cell of fcc?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 1/3
- B. 1/4
- C. 1/12
- D. 1/2
Correct answer & explanation hidden
Log in to view solution →
Q94
CHEMISTRY
Unit 10: p-Block Elements
Match List-I with List-II:
List-I (Oxoacids of Sulphur) | List-II (Bonds)
A. Peroxodisulphuric acid | I. Two S-OH, Four S=O, One S-O-S
B. Sulphuric acid | II. Two S-OH, One S=O
C. Pyrosulphuric acid | III. Two S-OH, Four S=O, One S-O-O-S
D. Sulphurous acid | IV. Two S-OH, Two S=O
Choose the correct answer:
↻ Repeated question — also appeared in
2023 (1 set)
- A. A-III, B-IV, C-I, D-II
- B. A-I, B-III, C-IV, D-II
- C. A-III, B-IV, C-II, D-I
- D. A-I, B-III, C-II, D-IV
Correct answer & explanation hidden
Log in to view solution →
Q95
CHEMISTRY
Unit 5: Solutions
Pumice stone is an example of -
↻ Repeated question — also appeared in
2023 (7 sets)
- A. gel
- B. solid sol
- C. foam
- D. sol
Correct answer & explanation hidden
Log in to view solution →
Q96
CHEMISTRY
Unit 17: Organic Compounds Containing Oxygen
Which amongst the following will be most readily dehydrated under acidic conditions?
- A. (1)
- B. (2)
- C. (3)
- D. (4)
Correct answer & explanation hidden
Log in to view solution →
Q97
CHEMISTRY
Unit 4: Chemical Thermodynamics
Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
↻ Repeated question — also appeared in
2023 (6 sets)
- A. $\Delta H = \Delta U + \Delta n_g RT$
- B. $\Delta H - \Delta U = -\Delta n_g RT$
- C. $\Delta H + \Delta U = \Delta nR$
- D. $\Delta H = \Delta U - \Delta n_g RT$
Correct answer & explanation hidden
Log in to view solution →
Q99
CHEMISTRY
Unit 6: Equilibrium
The equilibrium concentrations of the species in the reaction $A + B \rightleftharpoons C + D$ are 2, 3, 10 and 6 mol $L^{-1}$, respectively at 300 K. $\Delta G^0$ for the reaction is ($R = 2$ cal / mol K)
↻ Repeated question — also appeared in
2023 (7 sets)
- A. -137.26 cal
- B. -1381.80 cal
- C. -13.73 cal
- D. 1372.60 cal
Correct answer & explanation hidden
Log in to view solution →
Q99
CHEMISTRY
Unit 6: Equilibrium
The equilibrium concentrations of the species in the reaction A + B $\rightleftharpoons$ C + D are 2, 3, 10 and 6 mol L$^{-1}$, respectively at 300 K. $\Delta G^{\circ}$ for the reaction is (R = 2 cal / mol K)
↻ Repeated question — also appeared in
2023 (7 sets)
- A. -137.26 cal
- B. -1381.80 cal
- C. -13.73 cal
- D. 1372.60 cal
Correct answer & explanation hidden
Log in to view solution →
Q100
CHEMISTRY
Unit 11: d- and f-Block Elements
The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. $FeO + CO \rightarrow Fe + CO_2$
- B. $C + CO_2 \rightarrow 2CO$
- C. $CaO + SiO_2 \rightarrow CaSiO_3$
- D. $Fe_2O_3 + CO \rightarrow 2FeO + CO_2$
Correct answer & explanation hidden
Log in to view solution →
Q100
CHEMISTRY
Unit 10: p-Block Elements
The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is :
↻ Repeated question — also appeared in
2023 (1 set)
- A. FeO + CO $\rightarrow$ Fe + CO$_2$
- B. C + CO$_2$ $\rightarrow$ 2CO
- C. CaO + SiO$_2$ $\rightarrow$ CaSiO$_3$
- D. Fe$_2$O$_3$ + CO $\rightarrow$ 2FeO + CO$_2$
Correct answer & explanation hidden
Log in to view solution →
Q101
BIOLOGY
Unit 4: Plant Physiology
Which micronutrient is required for splitting of water molecule during photosynthesis?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. molybdenum
- B. magnesium
- C. copper
- D. manganese
Correct answer & explanation hidden
Log in to view solution →
Q102
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Given below are two statements :
Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II : Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Both Statement I and Statement II are false.
- B. Statement I is correct but Statement II is false.
- C. Statement I is incorrect but Statement II is true.
- D. Both Statement I and Statement II are true.
Correct answer & explanation hidden
Log in to view solution →
Q103
BIOLOGY
Unit 7: Genetics and Evolution
Unequivocal proof that DNA is the genetic material was first proposed by
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Alfred Hershey and Martha Chase
- B. Avery, Macleoid and McCarthy
- C. Wilkins and Franklin
- D. Frederick Griffith
Correct answer & explanation hidden
Log in to view solution →
Q104
BIOLOGY
Unit 7: Genetics and Evolution
The phenomenon of pleiotropism refers to
↻ Repeated question — also appeared in
2023 (7 sets)
- A. presence of two alleles, each of the two genes controlling a single trait.
- B. a single gene affecting multiple phenotypic expression.
- C. more than two genes affecting a single character.
- D. presence of several alleles of a single gene controlling a single crossover.
Correct answer & explanation hidden
Log in to view solution →
Q105
BIOLOGY
Unit 9: Biotechnology and Its Applications
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Bright blue colour
- B. Bright yellow colour
- C. Bright orange colour
- D. Bright red colour
Correct answer & explanation hidden
Log in to view solution →
Q106
BIOLOGY
Unit 6: Reproduction
Large, colourful, fragrant flowers with nectar are seen in:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. bird pollinated plants
- B. bat pollinated plants
- C. wind pollinated plants
- D. insect pollinated plants
Correct answer & explanation hidden
Log in to view solution →
Q107
BIOLOGY
Unit 3: Cell Structure and Function
Among eukaryotes, replication of DNA takes place in -
↻ Repeated question — also appeared in
2023 (8 sets)
- A. S phase
- B. G1 phase
- C. G2 phase
- D. M phase
Correct answer & explanation hidden
Log in to view solution →
Q108
BIOLOGY
Unit 7: Genetics and Evolution
Expressed Sequence Tags (ESTs) refers to
↻ Repeated question — also appeared in
2023 (4 sets)
- A. All genes that are expressed as proteins.
- B. All genes whether expressed or unexpressed.
- C. Certain important expressed genes.
- D. All genes that are expressed as RNA.
Correct answer & explanation hidden
Log in to view solution →
Q109
BIOLOGY
Unit 10: Ecology and Environment
Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Over exploitation for economic gain
- B. Alien species invasions
- C. Co-extinctions
- D. Habitat loss and fragmentation
Correct answer & explanation hidden
Log in to view solution →
Q110
BIOLOGY
Unit 4: Plant Physiology
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : ATP is used at two steps in glycolysis.
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Both A and R are true but R is NOT the correct explanation of A.
- B. A is true but R is false.
- C. A is false but R is true.
- D. Both A and R are true and R is the correct explanation of A.
Correct answer & explanation hidden
Log in to view solution →
Q112
BIOLOGY
Unit 10: Ecology and Environment
The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year :
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 1992
- B. 1986
- C. 2002
- D. 1985
Correct answer & explanation hidden
Log in to view solution →
Q114
BIOLOGY
Unit 4: Plant Physiology
The reaction centre in PS II has an absorption maxima at
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 700 nm
- B. 660 nm
- C. 780 nm
- D. 680 nm
Correct answer & explanation hidden
Log in to view solution →
Q116
BIOLOGY
Unit 4: Plant Physiology
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Dedifferentiation
- B. Development
- C. Senescence
- D. Differentiation
Correct answer & explanation hidden
Log in to view solution →
Q117
BIOLOGY
Unit 9: Biotechnology and Its Applications
During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
↻ Repeated question — also appeared in
2023 (7 sets)
- A. DNA
- B. Histones
- C. Polysaccharides
- D. RNA
Correct answer & explanation hidden
Log in to view solution →
Q118
CHEMISTRY
Unit 19: Biomolecules
Cellulose does not form blue colour with Iodine because
↻ Repeated question — also appeared in
2023 (7 sets)
- A. It is a helical molecule.
- B. It does not contain complex helices and hence cannot hold iodine molecules.
- C. It breakes down when iodine reacts with it.
- D. It is a disaccharide.
Correct answer & explanation hidden
Log in to view solution →
Q119
BIOLOGY
Unit 4: Plant Physiology
Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Gibberellic Acid
- B. Zeatin
- C. Abscisic Acid
- D. Indole-3-butyric Acid
Correct answer & explanation hidden
Log in to view solution →
Q120
BIOLOGY
Unit 1: Diversity in Living World
Identify the pair of heterosporous pteridophytes among the following :
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Selaginella and Salvinia
- B. Psilotum and Salvinia
- C. Equisetum and Salvinia
- D. Lycopodium and Selaginella
Correct answer & explanation hidden
Log in to view solution →
Q121
BIOLOGY
Unit 3: Cell Structure and Function
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
↻ Repeated question — also appeared in
2023 (2 sets)
- A. Pachytene
- B. Diplotene
- C. Diakinesis
- D. Zygotene
Correct answer & explanation hidden
Log in to view solution →
Q122
BIOLOGY
Unit 4: Plant Physiology
Which hormone promotes internode/petiole elongation in deep water rice?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Kinetin
- B. Ethylene
- C. 2, 4-D
- D. GA3
Correct answer & explanation hidden
Log in to view solution →
Q123
BIOLOGY
Unit 7: Genetics and Evolution
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Sutton and Boveri
- B. Alfred Sturtevant
- C. Henking
- D. Thomas Hunt Morgan
Correct answer & explanation hidden
Log in to view solution →
Q124
BIOLOGY
Unit 4: Plant Physiology
How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 18 ATP and 12 NADPH2
- B. 12 ATP and 16 NADPH2
- C. 18 ATP and 16 NADPH2
- D. 12 ATP and 12 NADPH2
Correct answer & explanation hidden
Log in to view solution →
Q125
BIOLOGY
Unit 1: Diversity in Living World
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from the options given below :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Both A and R are correct but R is NOT the correct explanation of A.
- B. A is correct but R is not correct.
- C. A is not correct but R is correct.
- D. Both A and R are correct and R is the correct explanation of A.
Correct answer & explanation hidden
Log in to view solution →
Q126
BIOLOGY
Unit 3: Cell Structure and Function
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Transcription of tRNA, 5 srRNA and snRNA
- B. Transcription of precursor of mRNA
- C. Transcription of only snRNAs
- D. Transcription of rRNAs (28S, 18S and 5.8S)
Correct answer & explanation hidden
Log in to view solution →
Q127
BIOLOGY
Unit 10: Ecology and Environment
The thickness of ozone in a column of air in the atmosphere is measured in terms of :
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Decibels
- B. Decameter
- C. Kilobase
- D. Dobson units
Correct answer & explanation hidden
Log in to view solution →
Q128
BIOLOGY
Unit 4: Plant Physiology
Given below are two statements :
Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below :
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Both Statement I and Statement II are incorrect.
- B. Statement I is correct but Statement II is incorrect.
- C. Statement I is incorrect but Statement II is correct.
- D. Both Statement I and Statement II are correct.
Correct answer & explanation hidden
Log in to view solution →
Q128
BIOLOGY
Unit 4: Plant Physiology
Given below are two statements :
Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below :
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Both Statement I and Statement II are incorrect.
- B. Statement I is correct but Statement II is incorrect.
- C. Statement I is incorrect but Statement II is correct.
- D. Both Statement I and Statement II are correct.
Correct answer & explanation hidden
Log in to view solution →
Q129
BIOLOGY
Unit 10: Ecology and Environment
In the equation GPP - R = NPP
GPP is Gross Primary Productivity
NPP is Net Primary Productivity
R here is
↻ Repeated question — also appeared in
2023 (9 sets)
- A. Respiratory quotient
- B. Respiratory loss
- C. Reproductive allocation
- D. Photosynthetically active radiation
Correct answer & explanation hidden
Log in to view solution →
Q129
BIOLOGY
Unit 10: Ecology and Environment
In the equation GPP - R = NPP
GPP is Gross Primary Productivity
NPP is Net Primary Productivity
R here is _________.
↻ Repeated question — also appeared in
2023 (9 sets)
- A. Respiratory quotient
- B. Respiratory loss
- C. Reproductive allocation
- D. Photosynthetically active radiation
Correct answer & explanation hidden
Log in to view solution →
Q130
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
↻ Repeated question — also appeared in
2023 (4 sets)
- A. Polyadelphous and epipetalous stamens
- B. Monoadelphous and Monothecous anthers
- C. Epiphyllous and Dithecous anthers
- D. Diadelphous and Dithecous anthers
Correct answer & explanation hidden
Log in to view solution →
Q131
BIOLOGY
Unit 9: Biotechnology and Its Applications
In gene gun method used to introduce alien DNA into host cells, microparticles of _________ metal are used.
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Zinc
- B. Tungsten or gold
- C. Silver
- D. Copper
Correct answer & explanation hidden
Log in to view solution →
Q132
BIOLOGY
Unit 4: Plant Physiology
Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Facilitated Diffusion
- B. Passive Transport
- C. Active Transport
- D. Osmosis
Correct answer & explanation hidden
Log in to view solution →
Q133
BIOLOGY
Unit 3: Cell Structure and Function
Which of the following stages of meiosis involves division of centromere?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Metaphase II
- B. Anaphase II
- C. Telophase
- D. Metaphase I
Correct answer & explanation hidden
Log in to view solution →
Q134
BIOLOGY
Unit 6: Reproduction
In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Antipodals, synergids, and primary endosperm nucleus
- B. Synergids, Zygote and Primary endosperm nucleus
- C. Synergids, antipodals and Polar nuclei
- D. Synergids, Primary endosperm nucleus and zygote
Correct answer & explanation hidden
Log in to view solution →
Q135
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Late wood has fewer xylary elements with narrow vessels.
Reason R : Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Both A and R are true but R is NOT the correct explanation of A.
- B. A is true but R is false.
- C. A is false but R is true.
- D. Both A and R are true and R is the correct explanation of A.
Correct answer & explanation hidden
Log in to view solution →
Q136
BIOLOGY
Unit 4: Plant Physiology
Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Amylase
- B. Lipase
- C. Dinitrogenase
- D. Succinic dehydrogenase
Correct answer & explanation hidden
Log in to view solution →
Q138
BIOLOGY
Unit 10: Ecology and Environment
Which one of the following statements is NOT correct?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.
- B. Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body.
- C. The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels.
- D. The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms.
Correct answer & explanation hidden
Log in to view solution →
Q139
BIOLOGY
Unit 4: Plant Physiology
Match List I with List II :
List I (Process) | List II (Associated Component/Pathway)
A. Oxidative decarboxylation | I. Citrate synthase
B. Glycolysis | II. Pyruvate dehydrogenase
C. Oxidative phosphorylation | III. Electron transport system
D. Tricarboxylic acid cycle | IV. EMP pathway
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. (1) A-II, B-IV, C-I, D-III
- B. (2) A-III, B-I, C-II, D-IV
- C. (3) A-II, B-IV, C-III, D-I
- D. (4) A-III, B-IV, C-II, D-I
Correct answer & explanation hidden
Log in to view solution →
Q140
BIOLOGY
Unit 7: Genetics and Evolution
Which of the following statements are correct about Klinefelter's Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. (1) C and D only
- B. (2) B and E only
- C. (3) A and E only
- D. (4) A and B only
Correct answer & explanation hidden
Log in to view solution →
Q141
BIOLOGY
Unit 10: Ecology and Environment
Match List I with List II :
List I (Interaction) | List II (Species A and B)
A. Mutualism | I. + (A), O(B)
B. Commensalism | II. - (A), O(B)
C. Amensalism | III. + (A), - (B)
D. Parasitism | IV. + (A), + (B)
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. (1) A-IV, B-I, C-II, D-III
- B. (2) A-IV, B-III, C-I, D-II
- C. (3) A-III, B-I, C-IV, D-II
- D. (4) A-IV, B-II, C-I, D-III
Correct answer & explanation hidden
Log in to view solution →
Q142
BIOLOGY
Unit 4: Plant Physiology
Match List I with List II:
List I | List II
A. Cohesion | I. More attraction in liquid phase
B. Adhesion | II. Mutual attraction among water molecules
C. Surface tension | III. Water loss in liquid phase
D. Guttation | IV. Attraction towards polar surfaces
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. (1) A-IV, B-III, C-II, D-I
- B. (2) A-III, B-I, C-IV, D-II
- C. (3) A-II, B-I, C-IV, D-III
- D. (4) A-II, B-IV, C-I, D-III
Correct answer & explanation hidden
Log in to view solution →
Q143
BIOLOGY
Unit 10: Ecology and Environment
Given below are two statements :
Statement I : Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II : In general, carnivores are more adversely affected by competition than herbivores.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. (1) Both Statement I and Statement II are false.
- B. (2) Statement I is correct but Statement II is false.
- C. (3) Statement I is incorrect but Statement II is true.
- D. (4) Both Statement I and Statement II are true.
Correct answer & explanation hidden
Log in to view solution →
Q144
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Identify the correct statements :
A. Lenticels are the lens-shaped openings permitting the exchange of gases.
B. Bark formed early in the season is called hard bark.
C. Bark is a technical term that refers to all tissues exterior to vascular cambium.
D. Bark refers to periderm and secondary phloem.
E. Phellogen is single-layered in thickness.
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. (1) A and D only
- B. (2) A, B and D only
- C. (3) B and C only
- D. (4) B, C and E only
Correct answer & explanation hidden
Log in to view solution →
Q145
BIOLOGY
Unit 1: Diversity in Living World
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.
Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (1 set)
- A. (1) Both A and R are true but R is NOT the correct explanation of A.
- B. (2) A is true but R is false.
- C. (3) A is false but R is true.
- D. (4) Both A and R are true and R is the correct explanation of A.
Correct answer & explanation hidden
Log in to view solution →
Q146
BIOLOGY
Unit 9: Biotechnology and Its Applications
Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.
A. Insertion of recombinant DNA into the host cell.
B. Cutting of DNA at specific location by restriction enzyme.
C. Isolation of desired DNA fragment.
D. Amplification of gene of interest using PCR.
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. (1) C, A, B, D
- B. (2) C, B, D, A
- C. (3) B, D, A, C
- D. (4) B, C, D, A
Correct answer & explanation hidden
Log in to view solution →
Q147
BIOLOGY
Unit 3: Cell Structure and Function
Match List I with List II:
List I | List II
A. M Phase | I. Proteins are synthesized
B. G2 Phase | II. Inactive phase
C. Quiescent stage | III. Interval between mitosis and initiation of DNA replication
D. G1 Phase | IV. Equational division
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. (1) A-IV, B-II, C-I, D-III
- B. (2) A-IV, B-I, C-II, D-III
- C. (3) A-II, B-IV, C-I, D-III
- D. (4) A-III, B-II, C-IV, D-I
Correct answer & explanation hidden
Log in to view solution →
Q147
BIOLOGY
Unit 3: Cell Structure and Function
Match List I with List II :
| List I | List II |
| :--- | :--- |
| A. M Phase | I. Proteins are synthesized |
| B. G2 Phase | II. Inactive phase |
| C. Quiescent stage | III. Interval between mitosis and initiation of DNA replication |
| D. G1 Phase | IV. Equational division |
Choose the correct answer from the options given below :
↻ Repeated question — also appeared in
2023 (8 sets)
- A. (1) A-IV, B-II, C-I, D-III
- B. (2) A-IV, B-I, C-II, D-III
- C. (3) A-II, B-IV, C-I, D-III
- D. (4) A-III, B-II, C-IV, D-I
Correct answer & explanation hidden
Log in to view solution →
Q148
BIOLOGY
Unit 3: Cell Structure and Function
How many different proteins does the ribosome consist of?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. (1) 60
- B. (2) 40
- C. (3) 20
- D. (4) 80
Correct answer & explanation hidden
Log in to view solution →
Q148
BIOLOGY
Unit 3: Cell Structure and Function
How many different proteins does the ribosome consist of?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. (1) 60
- B. (2) 40
- C. (3) 20
- D. (4) 80
Correct answer & explanation hidden
Log in to view solution →
Q149
BIOLOGY
Unit 4: Plant Physiology
Which of the following combinations is required for chemiosmosis?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. (1) membrane, proton pump, proton gradient, NADP synthase
- B. (2) proton pump, electron gradient, ATP synthase
- C. (3) proton pump, electron gradient, NADP synthase
- D. (4) membrane, proton pump, proton gradient, ATP synthase
Correct answer & explanation hidden
Log in to view solution →
Q149
BIOLOGY
Unit 4: Plant Physiology
Which of the following combinations is required for chemiosmosis?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. (1) membrane, proton pump, proton gradient, NADP synthase
- B. (2) proton pump, electron gradient, ATP synthase
- C. (3) proton pump, electron gradient, NADP synthase
- D. (4) membrane, proton pump, proton gradient, ATP synthase
Correct answer & explanation hidden
Log in to view solution →
Q150
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem.
Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. (1) Both A and R are true but R is NOT the correct explanation of A.
- B. (2) A is true but R is false.
- C. (3) A is false but R is true.
- D. (4) Both A and R are true and R is the correct explanation of A.
Correct answer & explanation hidden
Log in to view solution →
Q151
BIOLOGY
Unit 3: Cell Structure and Function
Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic Reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. (1) A, C and E only
- B. (2) A and D only
- C. (3) A, D and E only
- D. (4) B and D only
Correct answer & explanation hidden
Log in to view solution →
Q152
BIOLOGY
Unit 5: Human Physiology
Match List I with List II.
| List I (Type of Joint) | List II (Found between) |
| :--- | :--- |
| A. Cartilaginous Joint | I. Between flat skull bones |
| B. Ball and Socket Joint | II. Between adjacent vertebrae in vertebral column |
| C. Fibrous Joint | III. Between carpal and metacarpal of thumb |
| D. Saddle Joint | IV. Between Humerus and Pectoral girdle |
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. (1) A-II, B-IV, C-I, D-III
- B. (2) A-I, B-IV, C-III, D-II
- C. (3) A-II, B-IV, C-III, D-I
- D. (4) A-III, B-I, C-II, D-IV
Correct answer & explanation hidden
Log in to view solution →
Q153
BIOLOGY
Unit 7: Genetics and Evolution
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
↻ Repeated question — also appeared in
2023 (7 sets)
- A. (1) Numbat, Spotted cuscus, Flying phalanger
- B. (2) Mole, Flying squirrel, Tasmanian tiger cat
- C. (3) Lemur, Anteater, Wolf
- D. (4) Tasmanian wolf, Bobcat, Marsupial mole
Correct answer & explanation hidden
Log in to view solution →
Q154
BIOLOGY
Unit 10: Ecology and Environment
Which of the following statements is correct?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. (1) Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.
- B. (2) Presence of large amount of nutrients in water restricts 'Algal Bloom'
- C. (3) Algal Bloom decreases fish mortality
- D. (4) Eutrophication refers to increase in domestic sewage and waste water in lakes.
Correct answer & explanation hidden
Log in to view solution →
Q155
BIOLOGY
Unit 7: Genetics and Evolution
Which one of the following symbols represents mating between relatives in human pedigree analysis?
↻ Repeated question — also appeared in
2023 (4 sets)
- A. (1)
- B. (2)
- C. (3)
- D. (4)
Correct answer & explanation hidden
Log in to view solution →
Q156
BIOLOGY
Unit 8: Biology and Human Welfare
Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
↻ Repeated question — also appeared in
2023 (1 set)
- A. (1) Serum and Urine analysis
- B. (2) Polymerase Chain Reaction (PCR) technique
- C. (3) Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
- D. (4) Recombinant DNA Technology
Correct answer & explanation hidden
Log in to view solution →
Q157
BIOLOGY
Unit 5: Human Physiology
Match List I with List II.
| List I | List II |
| :--- | :--- |
| A. P-wave | I. Beginning of systole |
| B. Q-wave | II. Repolarisation of ventricles |
| C. QRS complex | III. Depolarisation of atria |
| D. T-wave | IV. Depolarisation of ventricles |
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. (1) A-IV, B-III, C-II, D-I
- B. (2) A-II, B-IV, C-I, D-III
- C. (3) A-I, B-II, C-III, D-IV
- D. (4) A-III, B-I, C-IV, D-II
Correct answer & explanation hidden
Log in to view solution →
Q157
BIOLOGY
Unit 5: Human Physiology
Match List I with List II.
List I (Event) | List II (Description)
--- | ---
A. P-wave | I. Beginning of systole
B. Q-wave | II. Repolarisation of ventricles
C. QRS complex | III. Depolarisation of atria
D. T-wave | IV. Depolarisation of ventricles
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. A-IV, B-III, C-II, D-I
- B. A-II, B-IV, C-I, D-III
- C. A-I, B-II, C-III, D-IV
- D. A-III, B-I, C-IV, D-II
Correct answer & explanation hidden
Log in to view solution →
Q158
BIOLOGY
Unit 7: Genetics and Evolution
Broad palm with single palm crease is visible in a person suffering from-
↻ Repeated question — also appeared in
2023 (8 sets)
- A. (1) Turner's syndrome
- B. (2) Klinefelter's syndrome
- C. (3) Thalassemia
- D. (4) Down's syndrome
Correct answer & explanation hidden
Log in to view solution →
Q158
BIOLOGY
Unit 7: Genetics and Evolution
Broad palm with single palm crease is visible in a person suffering from-
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Turner's syndrome
- B. Klinefelter's syndrome
- C. Thalassemia
- D. Down's syndrome
Correct answer & explanation hidden
Log in to view solution →
Q159
BIOLOGY
Unit 5: Human Physiology
Match List I with List II.
| List I (Cells) | List II (Secretion) |
| :--- | :--- |
| A. Peptic cells | I. Mucus |
| B. Goblet cells | II. Bile juice |
| C. Oxyntic cells | III. Proenzyme pepsinogen |
| D. Hepatic cells | IV. HCl and intrinsic factor |
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. (1) A-II, B-I, C-III, D-IV
- B. (2) A-III, B-I, C-IV, D-II
- C. (3) A-II, B-IV, C-I, D-III
- D. (4) A-IV, B-III, C-II, D-I
Correct answer & explanation hidden
Log in to view solution →
Q159
BIOLOGY
Unit 5: Human Physiology
Match List I with List II.
List I (Cells) | List II (Secretion)
--- | ---
A. Peptic cells | I. Mucus
B. Goblet cells | II. Bile juice
C. Oxyntic cells | III. Proenzyme pepsinogen
D. Hepatic cells | IV. HCl and intrinsic factor for absorption of vitamin $B_{12}$
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A-II, B-I, C-III, D-IV
- B. A-III, B-I, C-IV, D-II
- C. A-II, B-IV, C-I, D-III
- D. A-IV, B-III, C-II, D-I
Correct answer & explanation hidden
Log in to view solution →
Q160
BIOLOGY
Unit 5: Human Physiology
Which of the following statements are correct regarding female reproductive cycle?
A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B. First menstrual cycle begins at puberty and is called menopause.
C. Lack of menstruation may be indicative of pregnancy.
D. Cyclic menstruation extends between menarche and menopause.
Choose the most appropriate answer from the options given below:
↻ Repeated question — also appeared in
2023 (1 set)
- A. A and B only
- B. A, B and C only
- C. A, C and D only
- D. A and D only
Correct answer & explanation hidden
Log in to view solution →
Q161
BIOLOGY
Unit 3: Cell Structure and Function
Given below are two statements:
Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Both Statement I and Statement II are false.
- B. Statement I is true but Statement II is false.
- C. Statement I is false but Statement II is true.
- D. Both Statement I and Statement II are true.
Correct answer & explanation hidden
Log in to view solution →
Q162
BIOLOGY
Unit 5: Human Physiology
Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by-
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Ileo-caecal valve
- B. Gastro-oesophageal sphincter
- C. Pyloric sphincter
- D. Sphincter of Oddi
Correct answer & explanation hidden
Log in to view solution →
Q163
BIOLOGY
Unit 1: Diversity in Living World
Match List I with List II.
List I | List II
--- | ---
A. Taenia | I. Nephridia
B. Paramoecium | II. Contractile vacuole
C. Periplaneta | III. Flame cells
D. Pheretima | IV. Urecose gland
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (3 sets)
- A. A-I, B-II, C-IV, D-III
- B. A-III, B-II, C-IV, D-I
- C. A-II, B-I, C-IV, D-III
- D. A-I, B-II, C-III, D-IV
Correct answer & explanation hidden
Log in to view solution →
Q164
BIOLOGY
Unit 5: Human Physiology
Match List I with List II with respect to human eye.
List I | List II
--- | ---
A. Fovea | I. Visible coloured portion of eye that regulates diameter of pupil.
B. Iris | II. External layer of eye formed of dense connective tissue.
C. Blind spot | III. Point of greatest visual acuity or resolution.
D. Sclera | IV. Point where optic nerve leaves the eyeball and photoreceptor cells are absent.
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. A-IV, B-III, C-II, D-I
- B. A-I, B-IV, C-III, D-II
- C. A-II, B-I, C-III, D-IV
- D. A-III, B-I, C-IV, D-II
Correct answer & explanation hidden
Log in to view solution →
Q165
BIOLOGY
Unit 7: Genetics and Evolution
Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Both Statement I and Statement II are false.
- B. Statement I is true but Statement II is false.
- C. Statement I false but Statement II is true.
- D. Both Statement I and Statement II are true.
Correct answer & explanation hidden
Log in to view solution →
Q166
BIOLOGY
Unit 5: Human Physiology
Match List I with List II.
List I | List II
--- | ---
A. CCK | I. Kidney
B. GIP | II. Heart
C. ANF | III. Gastric gland
D. ADH | IV. Pancreas
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. A-III, B-II, C-IV, D-I
- B. A-II, B-IV, C-I, D-III
- C. A-IV, B-II, C-III, D-I
- D. A-IV, B-III, C-II, D-I
Correct answer & explanation hidden
Log in to view solution →
Q166
BIOLOGY
Unit 5: Human Physiology
Match List I with List II.
List I | List II
--- | ---
A. CCK | I. Kidney
B. GIP | II. Heart
C. ANF | III. Gastric gland
D. ADH | IV. Pancreas
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. A-III, B-II, C-IV, D-I
- B. A-II, B-IV, C-I, D-III
- C. A-IV, B-II, C-III, D-I
- D. A-IV, B-III, C-II, D-I
Correct answer & explanation hidden
Log in to view solution →
Q167
BIOLOGY
Unit 5: Human Physiology
Vital capacity of lung is ______.
↻ Repeated question — also appeared in
2023 (7 sets)
- A. IRV + ERV + TV + RV
- B. IRV + ERV + TV - RV
- C. IRV + ERV + TV
- D. IRV + ERV
Correct answer & explanation hidden
Log in to view solution →
Q167
BIOLOGY
Unit 5: Human Physiology
Vital capacity of lung is:
- A. IRV + ERV + TV + RV
- B. IRV + ERV + TV - RV
- C. IRV + ERV + TV
- D. IRV + ERV
Correct answer & explanation hidden
Log in to view solution →
Q168
BIOLOGY
Unit 9: Biotechnology and Its Applications
Which of the following is not a cloning vector?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. YAC
- B. pBR322
- C. Probe
- D. BAC
Correct answer & explanation hidden
Log in to view solution →
Q168
BIOLOGY
Unit 9: Biotechnology and Its Applications
Which of the following is not a cloning vector?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. YAC
- B. pBR322
- C. Probe
- D. BAC
Correct answer & explanation hidden
Log in to view solution →
Q169
BIOLOGY
Unit 7: Genetics and Evolution
Match List I with List II.
List I | List II
--- | ---
A. Gene 'a' | I. $\beta$-galactosidase
B. Gene 'y' | II. Transacetylase
C. Gene 'i' | III. Permease
D. Gene 'z' | IV. Repressor protein
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. A-II, B-III, C-IV, D-I
- B. A-III, B-IV, C-I, D-II
- C. A-III, B-I, C-IV, D-II
- D. A-II, B-I, C-IV, D-III
Correct answer & explanation hidden
Log in to view solution →
Q169
BIOLOGY
Unit 7: Genetics and Evolution
Match List I with List II (regarding lac operon).
List I | List II
--- | ---
A. Gene 'a' | I. $\beta$-galactosidase
B. Gene 'y' | II. Transacetylase
C. Gene 'i' | III. Permease
D. Gene 'z' | IV. Repressor protein
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. A-II, B-III, C-IV, D-I
- B. A-III, B-IV, C-I, D-II
- C. A-III, B-I, C-IV, D-II
- D. A-II, B-I, C-IV, D-III
Correct answer & explanation hidden
Log in to view solution →
Q170
BIOLOGY
Unit 6: Reproduction
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Endometrium is necessary for implantation of blastocyst.
Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (4 sets)
- A. Both A and R are true but R is NOT the correct explanation of A.
- B. A is true but R is false.
- C. A is false but R is true.
- D. Both A and R are true and R is the correct explanation of A.
Correct answer & explanation hidden
Log in to view solution →
Q171
BIOLOGY
Unit 6: Reproduction
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.
Reason R: Ban on amniocentesis checks increasing menace of female foeticide.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. Both A and R are true and R is NOT the correct explanation of A.
- B. A is true but R is false.
- C. A is false but R is true.
- D. Both A and R are true and R is the correct explanation of A.
Correct answer & explanation hidden
Log in to view solution →
Q172
BIOLOGY
Unit 8: Biology and Human Welfare
Match List I with List II.
List I | List II
--- | ---
A. Heroin | I. Effect on cardiovascular system
B. Marijuana | II. Slow down body function
C. Cocaine | III. Painkiller
D. Morphine | IV. Interfere with transport of dopamine
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. A-I, B-II, C-III, D-IV
- B. A-IV, B-III, C-II, D-I
- C. A-III, B-IV, C-I, D-II
- D. A-II, B-I, C-IV, D-III
Correct answer & explanation hidden
Log in to view solution →
Q173
BIOLOGY
Unit 8: Biology and Human Welfare
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. B-lymphocytes
- B. Basophils
- C. Eosinophils
- D. TH cells
Correct answer & explanation hidden
Log in to view solution →
Q174
BIOLOGY
Unit 8: Biology and Human Welfare
Match List I with List II.
List I | List II
--- | ---
A. Ringworm | I. Haemophilus influenzae
B. Filariasis | II. Trichophyton
C. Malaria | III. Wuchereria bancrofti
D. Pneumonia | IV. Plasmodium vivax
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. A-II, B-III, C-I, D-IV
- B. A-III, B-II, C-I, D-IV
- C. A-III, B-II, C-IV, D-I
- D. A-II, B-III, C-IV, D-I
Correct answer & explanation hidden
Log in to view solution →
Q175
BIOLOGY
Unit 8: Biology and Human Welfare
Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
↻ Repeated question — also appeared in
2023 (2 sets)
- A. Gonorrhoea
- B. Hepatitis-B
- C. HIV Infection
- D. Genital herpes
Correct answer & explanation hidden
Log in to view solution →
Q176
BIOLOGY
Unit 6: Reproduction
Match List I with List II.
List I | List II
--- | ---
A. Vasectomy | I. Oral method
B. Coitus interruptus | II. Barrier method
C. Cervical caps | III. Surgical method
D. Saheli | IV. Natural method
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (4 sets)
- A. A-III, B-IV, C-II, D-I
- B. A-II, B-III, C-I, D-IV
- C. A-IV, B-II, C-I, D-III
- D. A-III, B-I, C-IV, D-II
Correct answer & explanation hidden
Log in to view solution →
Q177
BIOLOGY
Unit 1: Diversity in Living World
Radial symmetry is NOT found in adults of phylum _______
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Hemichordata
- B. Coelenterata
- C. Echinodermata
- D. Ctenophora
Correct answer & explanation hidden
Log in to view solution →
Q177
BIOLOGY
Unit 1: Diversity in Living World
Radial symmetry is NOT found in adults of phylum ______.
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Hemichordata
- B. Coelenterata
- C. Echinodermata
- D. Ctenophora
Correct answer & explanation hidden
Log in to view solution →
Q178
CHEMISTRY
Unit 19: Biomolecules
Given below are two statements:
Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal).
Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of $\alpha$ type and two subunits of $\beta$ type.)
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. Both Statement I and Statement II are false.
- B. Statement I is true but Statement II is false.
- C. Statement I is false but Statement II is true.
- D. Both Statement I and Statement II are true.
Correct answer & explanation hidden
Log in to view solution →
Q178
CHEMISTRY
Unit 19: Biomolecules
Given below are two statements:
Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal)
Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of $\alpha$ type and two subunits of $\beta$ type.)
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. Both Statement I and Statement II are false.
- B. Statement I is true but Statement II is false.
- C. Statement I is false but Statement II is true.
- D. Both Statement I and Statement II are true.
Correct answer & explanation hidden
Log in to view solution →
Q195
PHYSICS
Unit 18: Atoms and Nuclei
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
- A. 3' UAGCUAGCUAGCUAGCUA GCUAGCUAGC 5'
- B. 5' ATCGATCGATCGATCGATCG ATCGATCG 3'
- C. 3' ATCGATCGATCGATCGATCG ATCGATCG 5'
- D. 5' UAGCUAGCUAGCUAGCUA GCUAGC UAGC 3'
Correct answer & explanation hidden
Log in to view solution →