Q1
PHYSICS
Unit 2: Kinematics
A vehicle travels half the distance with speed $v$ and the remaining distance with speed $2v$. Its average speed is:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. $3v/4$
- B. $v/3$
- C. $2v/3$
- D. $4v/3$
Correct answer & explanation hidden
Log in to view solution →
Q2
PHYSICS
Unit 18: Atoms and Nuclei
The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to $(1/16)^{th}$ of its initial value?
↻ Repeated question — also appeared in
2023 (9 sets)
- A. 80 minutes
- B. 20 minutes
- C. 40 minutes
- D. 60 minutes
Correct answer & explanation hidden
Log in to view solution →
Q2
PHYSICS
Unit 18: Atoms and Nuclei
The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to $\frac{1}{16}$th of its initial value?
↻ Repeated question — also appeared in
2023 (9 sets)
- A. 80 minutes
- B. 20 minutes
- C. 40 minutes
- D. 60 minutes
Correct answer & explanation hidden
Log in to view solution →
Q3
PHYSICS
Unit 19: Electronic Devices
A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
↻ Repeated question — also appeared in
2023 (9 sets)
- A. Load resistance
- B. A centre-tapped transformer
- C. p-n junction diodes
- D. Capacitor
Correct answer & explanation hidden
Log in to view solution →
Q3
PHYSICS
Unit 19: Electronic Devices
A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
↻ Repeated question — also appeared in
2023 (9 sets)
- A. Load resistance
- B. A centre-tapped transformer
- C. p-n junction diodes
- D. Capacitor
Correct answer & explanation hidden
Log in to view solution →
Q4
PHYSICS
Unit 3: Laws of Motion
A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :
- A. along south-west
- B. along eastward
- C. along northward
- D. along north-east
Correct answer & explanation hidden
Log in to view solution →
Q4
PHYSICS
Unit 2: Kinematics
A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is:
↻ Repeated question — also appeared in
2023 (4 sets)
- A. along south-west
- B. along eastward
- C. along northward
- D. along north-east
Correct answer & explanation hidden
Log in to view solution →
Q5
PHYSICS
Unit 11: Electrostatics
An electric dipole is placed at an angle of $30^\circ$ with an electric field of intensity $2 \times 10^5 \text{ N C}^{-1}$. It experiences a torque equal to $4 \text{ N m}$. Calculate the magnitude of charge on the dipole, if the dipole length is $2 \text{ cm}$.
↻ Repeated question — also appeared in
2023 (9 sets)
- A. 2 mC
- B. 8 mC
- C. 6 mC
- D. 4 mC
Correct answer & explanation hidden
Log in to view solution →
Q5
PHYSICS
Unit 11: Electrostatics
An electric dipole is placed at an angle of 30° with an electric field of intensity $2 \times 10^5 \text{ N C}^{-1}$. It experiences a torque equal to 4 N m. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.
↻ Repeated question — also appeared in
2023 (9 sets)
- A. 2 mC
- B. 8 mC
- C. 6 mC
- D. 4 mC
Correct answer & explanation hidden
Log in to view solution →
Q6
PHYSICS
Unit 7: Properties of Solids and Liquids
The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly : (surface tension of soap solution = 0.03 N m$^{-1}$)
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 50.1 x 10$^{-4}$ J
- B. 30.16 x 10$^{-4}$ J
- C. 5.06 x 10$^{-4}$ J
- D. 3.01 x 10$^{-4}$ J
Correct answer & explanation hidden
Log in to view solution →
Q7
PHYSICS
Unit 12: Current Electricity
The magnitude and direction of the current in the following circuit is
↻ Repeated question — also appeared in
2023 (4 sets)
- A. 1.5 A from B to A through E
- B. 0.2 A from B to A through E
- C. 0.5 A from A to B through E
- D. 5/9 A from A to B through E
Correct answer & explanation hidden
Log in to view solution →
Q8
PHYSICS
Unit 12: Current Electricity
Resistance of a carbon resistor determined from colour codes is $(22000 \pm 5\%) \Omega$. The colour of third band must be :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Yellow
- B. Red
- C. Green
- D. Orange
Correct answer & explanation hidden
Log in to view solution →
Q9
PHYSICS
Unit 1: Physics and Measurement
A metal wire has mass $(0.4 \pm 0.002) \text{ g}$, radius $(0.3 \pm 0.001) \text{ mm}$ and length $(5 \pm 0.02) \text{ cm}$. The maximum possible percentage error in the measurement of density will nearly be:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 1.4%
- B. 1.2%
- C. 1.3%
- D. 1.6%
Correct answer & explanation hidden
Log in to view solution →
Q10
PHYSICS
Unit 6: Gravitation
Two bodies of mass $m$ and $9m$ are placed at a distance $R$. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be (G = gravitational constant) :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. $-20Gm/R$
- B. $-8Gm/R$
- C. $-12Gm/R$
- D. $-16Gm/R$
Correct answer & explanation hidden
Log in to view solution →
Q13
PHYSICS
Unit 10: Oscillations and Waves
The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 3 : 1
- B. 1 : 2
- C. 2 : 1
- D. 1 : 3
Correct answer & explanation hidden
Log in to view solution →
Q14
PHYSICS
Unit 17: Dual Nature of Matter and Radiation
The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons?
↻ Repeated question — also appeared in
2023 (4 sets)
- A. Na only
- B. Cs only
- C. Both Na and K
- D. K only
Correct answer & explanation hidden
Log in to view solution →
Q15
PHYSICS
Unit 11: Electrostatics
The net magnetic flux through any closed surface is:
↻ Repeated question — also appeared in
2023 (1 set)
- A. Negative
- B. Zero
- C. Positive
- D. Infinity
Correct answer & explanation hidden
Log in to view solution →
Q16
PHYSICS
Unit 7: Properties of Solids and Liquids
Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Zero
- B. 2W/A
- C. W / A
- D. W/2A
Correct answer & explanation hidden
Log in to view solution →
Q17
PHYSICS
Unit 18: Atoms and Nuclei
The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to:
↻ Repeated question — also appeared in
2023 (2 sets)
- A. V^2
- B. \sqrt{V}
- C. 1/V
- D. 1/\sqrt{V}
Correct answer & explanation hidden
Log in to view solution →
Q18
PHYSICS
Unit 8: Thermodynamics
A Carnot engine has an efficiency of 50% when its source is at a temperature 327° C. The temperature of the sink is:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 200° C
- B. 27° C
- C. 15° C
- D. 100° C
Correct answer & explanation hidden
Log in to view solution →
Q20
PHYSICS
Unit 9: Kinetic Theory of Gases
The temperature of a gas is -50° C. To what temperature the gas should be heated so that the rms speed is increased by 3 times?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 223 K
- B. 669° C
- C. 3295° C
- D. 3097 K
Correct answer & explanation hidden
Log in to view solution →
Q21
PHYSICS
Unit 2: Kinematics
A bullet is fired from a gun at the speed of 280 m/s in the direction 30° above the horizontal. The maximum height attained by the bullet is (g = 9.8 m/s^2, sin 30° = 0.5):
↻ Repeated question — also appeared in
2023 (6 sets)
- A. 3000 m
- B. 2800 m
- C. 2000 m
- D. 1000 m
Correct answer & explanation hidden
Log in to view solution →
Q22
PHYSICS
Unit 16: Optics
For Young's double slit experiment, two statements are given below:
Statement I: If screen is moved away from the plane of slits, angular separation of the fringes remains constant.
Statement II: If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. Statement I is false but Statement II is true.
- B. Both Statement I and Statement II are true.
- C. Both Statement I and Statement II are false.
- D. Statement I is true but Statement II is false.
Correct answer & explanation hidden
Log in to view solution →
Q23
PHYSICS
Unit 13: Magnetic Effects of Current and Magnetism
The magnetic energy stored in an inductor of inductance 4 µH carrying a current of 2 A is:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. 8 µJ
- B. 4 µJ
- C. 4 mJ
- D. 8 mJ
Correct answer & explanation hidden
Log in to view solution →
Q24
PHYSICS
Unit 11: Electrostatics
If $\oint E \cdot dS = 0$ over a surface, then:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. the electric field inside the surface is necessarily uniform.
- B. the number of flux lines entering the surface must be equal to the number of flux lines leaving it.
- C. the magnitude of electric field on the surface is constant.
- D. all the charges must necessarily be inside the surface.
Correct answer & explanation hidden
Log in to view solution →
Q25
PHYSICS
Unit 4: Work Energy and Power
The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential energy stored in it will be:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 16U
- B. 2U
- C. 4U
- D. 8U
Correct answer & explanation hidden
Log in to view solution →
Q26
PHYSICS
Unit 14: Electromagnetic Induction and Alternating Currents
In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 µF and resistance R is 100 Ω. The frequency at which resonance occurs is:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 1.59 kHz
- B. 15.9 rad/s
- C. 15.9 kHz
- D. 1.59 rad/s
Correct answer & explanation hidden
Log in to view solution →
Q27
PHYSICS
Unit 15: Electromagnetic Waves
An ac source is connected to a capacitor C. Due to decrease in its operating frequency:
- A. capacitive reactance remains constant
- B. capacitive reactance decreases.
- C. displacement current increases.
- D. displacement current decreases.
Correct answer & explanation hidden
Log in to view solution →
Q28
PHYSICS
Unit 7: Properties of Solids and Liquids
The venturi-meter works on:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. The principle of perpendicular axes
- B. Huygen's principle
- C. Bernoulli's principle
- D. The principle of parallel axes
Correct answer & explanation hidden
Log in to view solution →
Q29
PHYSICS
Unit 14: Electromagnetic Induction and Alternating Currents
A 12 V, 60 W lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 0.37 A
- B. 0.27 A
- C. 2.7 A
- D. 3.7 A
Correct answer & explanation hidden
Log in to view solution →
Q30
PHYSICS
Unit 12: Current Electricity
If the galvanometer G does not show any deflection in the circuit shown, the value of R is given by:
↻ Repeated question — also appeared in
2023 (3 sets)
- A. 400 Ω
- B. 200 Ω
- C. 50 Ω
- D. 100 Ω
Correct answer & explanation hidden
Log in to view solution →
Q31
PHYSICS
Unit 15: Electromagnetic Waves
In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of $2.0 \times 10^{10} Hz$ and amplitude $48 Vm^{-1}$. Then the amplitude of oscillating magnetic field is: (Speed of light in free space= $3 \times 10^8 m s^{-1}$)
↻ Repeated question — also appeared in
2023 (9 sets)
- A. 1.6 \times 10^{-6} T
- B. 1.6 \times 10^{-9} T
- C. 1.6 \times 10^{-8} T
- D. 1.6 \times 10^{-7} T
Correct answer & explanation hidden
Log in to view solution →
Q31
PHYSICS
Unit 15: Electromagnetic Waves
In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of $2.0 \times 10^{10} \text{ Hz}$ and amplitude $48 \text{ Vm}^{-1}$. Then the amplitude of oscillating magnetic field is : (Speed of light in free space = $3 \times 10^8 \text{ m s}^{-1}$)
↻ Repeated question — also appeared in
2023 (9 sets)
- A. $1.6 \times 10^{-6} \text{ T}$
- B. $1.6 \times 10^{-9} \text{ T}$
- C. $1.6 \times 10^{-8} \text{ T}$
- D. $1.6 \times 10^{-7} \text{ T}$
Correct answer & explanation hidden
Log in to view solution →
Q32
PHYSICS
Unit 5: Rotational Motion
The angular acceleration of a body, moving along the circumference of a circle, is:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. along the axis of rotation
- B. along the radius, away from centre
- C. along the radius towards the centre
- D. along the tangent to its position
Correct answer & explanation hidden
Log in to view solution →
Q33
PHYSICS
Unit 11: Electrostatics
The equivalent capacitance of the system shown in the following circuit is:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 9 µF
- B. 2 µF
- C. 3 µF
- D. 6 µF
Correct answer & explanation hidden
Log in to view solution →
Q33
PHYSICS
Unit 11: Electrostatics
The equivalent capacitance of the system shown in the following circuit is :
↻ Repeated question — also appeared in
2023 (7 sets)
- A. $9 \text{ \mu F}$
- B. $2 \text{ \mu F}$
- C. $3 \text{ \mu F}$
- D. $6 \text{ \mu F}$
Correct answer & explanation hidden
Log in to view solution →
Q35
PHYSICS
Unit 16: Optics
Light travels a distance x in time $t_1$ in air and 10x in time $t_2$ in another denser medium. What is the critical angle for this medium?
↻ Repeated question — also appeared in
2023 (3 sets)
- A. $\sin^{-1}(\frac{10t_1}{t_2})$
- B. $\sin^{-1}(\frac{t_2}{t_1})$
- C. $\sin^{-1}(\frac{10t_2}{t_1})$
- D. $\sin^{-1}(\frac{t_1}{10t_2})$
Correct answer & explanation hidden
Log in to view solution →
Q36
PHYSICS
Unit 18: Atoms and Nuclei
The radius of inner most orbit of hydrogen atom is $5.3 \times 10^{-11} \text{ m}$. What is the radius of third allowed orbit of hydrogen atom?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. $4.77 \text{ \AA}$
- B. $0.53 \text{ \AA}$
- C. $1.06 \text{ \AA}$
- D. $1.59 \text{ \AA}$
Correct answer & explanation hidden
Log in to view solution →
Q39
PHYSICS
Unit 12: Current Electricity
10 resistors, each of resistance $R$ are connected in series to a battery of emf $E$ and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased $n$ times. The value of $n$ is :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. $1000$
- B. $10$
- C. $100$
- D. $1$
Correct answer & explanation hidden
Log in to view solution →
Q40
PHYSICS
Unit 2: Kinematics
A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity $4 \text{ m s}^{-1}$. The ball strikes the water surface after $4 \text{ s}$. The height of bridge above water surface is (Take $g = 10 \text{ m s}^{-2}$) :
↻ Repeated question — also appeared in
2023 (8 sets)
- A. $68 \text{ m}$
- B. $56 \text{ m}$
- C. $60 \text{ m}$
- D. $64 \text{ m}$
Correct answer & explanation hidden
Log in to view solution →
Q44
PHYSICS
Unit 14: Electromagnetic Induction and Alternating Currents
The net impedance of circuit (as shown in figure) will be :
↻ Repeated question — also appeared in
2023 (5 sets)
- A. $25 \text{ \Omega}$
- B. $10\sqrt{2} \text{ \Omega}$
- C. $15 \text{ \Omega}$
- D. $5\sqrt{5} \text{ \Omega}$
Correct answer & explanation hidden
Log in to view solution →
Q47
PHYSICS
Unit 19: Electronic Devices
For the following logic circuit, the truth table is:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. A=0 B=0 Y=0; A=0 B=1 Y=0; A=1 B=0 Y=0; A=1 B=1 Y=1
- B. A=0 B=0 Y=1; A=0 B=1 Y=1; A=1 B=0 Y=1; A=1 B=1 Y=0
- C. A=0 B=0 Y=0; A=0 B=1 Y=1; A=1 B=0 Y=1; A=1 B=1 Y=1
- D. A=0 B=0 Y=1; A=0 B=1 Y=0; A=1 B=0 Y=1; A=1 B=1 Y=0
Correct answer & explanation hidden
Log in to view solution →
Q47
PHYSICS
Unit 19: Electronic Devices
For the following logic circuit, the truth table is:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. A B Y 0 0 0 0 1 0 1 0 0 1 1 1
- B. A B Y 0 0 1 0 1 1 1 0 1 1 1 0
- C. A B Y 0 0 0 0 1 1 1 0 1 1 1 1
- D. A B Y 0 0 1 0 1 0 1 0 1 1 1 0
Correct answer & explanation hidden
Log in to view solution →
Q48
PHYSICS
Unit 16: Optics
In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)?
↻ Repeated question — also appeared in
2023 (5 sets)
- A. -50 cm
- B. 40 cm
- C. -40 cm
- D. -100 cm
Correct answer & explanation hidden
Log in to view solution →
Q48
PHYSICS
Unit 16: Optics
In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)?
↻ Repeated question — also appeared in
2023 (5 sets)
- A. -50 cm
- B. 40 cm
- C. -40 cm
- D. -100 cm
Correct answer & explanation hidden
Log in to view solution →
Q51
CHEMISTRY
Unit 6: Equilibrium
Amongst the given options which of the following molecules / ion acts as a Lewis acid?
↻ Repeated question — also appeared in
2023 (5 sets)
- A. OH⁻
- B. NH₃
- C. H₂O
- D. BF₃
Correct answer & explanation hidden
Log in to view solution →
Q61
CHEMISTRY
Unit 8: Chemical Kinetics
For a certain reaction, the rate = $k[A]^2[B]$, when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. increase by a factor of three.
- B. decrease by a factor of nine.
- C. increase by a factor of six.
- D. increase by a factor of nine.
Correct answer & explanation hidden
Log in to view solution →
Q62
CHEMISTRY
Unit 2: Atomic Structure
The element expected to form largest ion to achieve the nearest noble gas configuration is:
- A. Na
- B. O
- C. F
- D. N
Correct answer & explanation hidden
Log in to view solution →
Q62
CHEMISTRY
Unit 9: Classification of Elements and Periodicity in Properties
The element expected to form largest ion to achieve the nearest noble gas configuration is :
↻ Repeated question — also appeared in
2023 (5 sets)
- A. Na
- B. O
- C. F
- D. N
Correct answer & explanation hidden
Log in to view solution →
Q63
CHEMISTRY
Unit 8: Chemical Kinetics
Which one is an example of heterogenous catalysis?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron.
- B. Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen.
- C. Hydrolysis of sugar catalysed by $H^+$ ions.
- D. Decomposition of ozone in presence of nitrogen monoxide.
Correct answer & explanation hidden
Log in to view solution →
Q68
CHEMISTRY
Unit 9: Classification of Elements and Periodicity in Properties
Match List - I with List - II :
List - I | List - II
A. Coke | I. Carbon atoms are $sp^3$ hybridised.
B. Diamond | II. Used as a dry lubricant
C. Fullerene | III. Used as a reducing agent
D. Graphite | IV. Cage like molecules
- A. A-III, B-IV, C-I, D-II
- B. A-II, B-IV, C-I, D-III
- C. A-IV, B-I, C-II, D-III
- D. A-III, B-I, C-IV, D-II
Correct answer & explanation hidden
Log in to view solution →
Q71
CHEMISTRY
Unit 19: Biomolecules
Given below are two statements :
Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside
Statement II : When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. Statement I is false but Statement II is true.
- B. Both Statement I and Statement II are true.
- C. Both Statement I and Statement II are false.
- D. Statement I is true but Statement II is false.
Correct answer & explanation hidden
Log in to view solution →
Q72
CHEMISTRY
Unit 8: Chemical Kinetics
Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A reaction can have zero activation energy.
Reason R : The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true and R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q72
CHEMISTRY
Unit 8: Chemical Kinetics
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: A reaction can have zero activation energy.
Reason R: The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true and R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q74
PHYSICS
Unit 7: Properties of Solids and Liquids
Intermolecular forces are forces of attraction and repulsion between interacting particles that will include :
A. dipole-dipole forces.
B. dipole-induced dipole forces.
C. hydrogen bonding.
D. covalent bonding.
E. dispersion forces.
Choose the most appropriate answer from the options given below :
- A. A, C, D, E are correct.
- B. B, C, D, E are correct.
- C. A, B, C, D are correct.
- D. A, B, C, E are correct.
Correct answer & explanation hidden
Log in to view solution →
Q76
PHYSICS
Unit 7: Properties of Solids and Liquids
A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is $A_x B_y$, then the value of $x + y$ is:
↻ Repeated question — also appeared in
2023 (4 sets)
- A. 2
- B. 5
- C. 4
- D. 3
Correct answer & explanation hidden
Log in to view solution →
Q79
CHEMISTRY
Unit 10: p-Block Elements
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic.
Reason R: The deep blue solution is due to the formation of amide.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (2 sets)
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true but R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q81
CHEMISTRY
Unit 7: Redox Reactions and Electrochemistry
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: In equation $\Delta_r G = -nFE_{cell}$, value of $\Delta_r G$ depends on n.
Reason R: $E_{cell}$ is an intensive property and $\Delta_r G$ is an extensive property.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true and R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q81
CHEMISTRY
Unit 7: Redox Reactions and Electrochemistry
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: In equation $\Delta_r G = -nFE_{cell}$, value of $\Delta_r G$ depends on $n$.
Reason R: $E_{cell}$ is an intensive property and $\Delta_r G$ is an extensive property.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true and R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q82
CHEMISTRY
Unit 10: p-Block Elements
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: Helium is used to dilute oxygen in diving apparatus.
Reason R: Helium has high solubility in $O_2$.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (2 sets)
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true and R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q83
CHEMISTRY
Unit 11: d- and f-Block Elements
The stability of $Cu^{2+}$ is more than $Cu^+$ salts in aqueous solution due to:
↻ Repeated question — also appeared in
2023 (9 sets)
- A. second ionisation enthalpy.
- B. first ionisation enthalpy.
- C. enthalpy of atomization.
- D. hydration energy.
Correct answer & explanation hidden
Log in to view solution →
Q83
CHEMISTRY
Unit 11: d- and f-Block Elements
The stability of $Cu^{2+}$ is more than $Cu^{+}$ salts in aqueous solution due to -
↻ Repeated question — also appeared in
2023 (9 sets)
- A. second ionisation enthalpy.
- B. first ionisation enthalpy.
- C. enthalpy of atomization.
- D. hydration energy.
Correct answer & explanation hidden
Log in to view solution →
Q84
CHEMISTRY
Unit 16: Organic Compounds Containing Halogens
The given compound shown in the image is an example of ________.
- A. vinylic halide
- B. benzylic halide
- C. aryl halide
- D. allylic halide
Correct answer & explanation hidden
Log in to view solution →
Q85
CHEMISTRY
Unit 12: Coordination Compounds
Homoleptic complex from the following complexes is:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Triamminetriaquachromium (III) chloride
- B. Potassium trioxalatoaluminate (III)
- C. Diamminechloridonitrito-N-platinum (II)
- D. Pentaamminecarbonatocobalt (III) chloride
Correct answer & explanation hidden
Log in to view solution →
Q85
CHEMISTRY
Unit 12: Coordination Compounds
Homoleptic complex from the following complexes is :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Triamminetriaquachromium (III) chloride
- B. Potassium trioxalatoaluminate (III)
- C. Diamminechloridonitrito - N - platinum (II)
- D. Pentaamminecarbonatocobalt (III) chloride
Correct answer & explanation hidden
Log in to view solution →
Q88
CHEMISTRY
Unit 6: Equilibrium
The equilibrium concentrations of the species in the reaction $A + B \rightleftharpoons C + D$ are 2, 3, 10 and 6 mol $L^{-1}$, respectively at 300 K. $\Delta G^0$ for the reaction is ($R = 2$ cal / mol K):
↻ Repeated question — also appeared in
2023 (7 sets)
- A. -13.73 cal
- B. 1372.60 cal
- C. -137.26 cal
- D. -1381.80 cal
Correct answer & explanation hidden
Log in to view solution →
Q88
CHEMISTRY
Unit 6: Equilibrium
The equilibrium concentrations of the species in the reaction $A + B \rightleftharpoons C + D$ are 2, 3, 10 and 6 mol $L^{-1}$, respectively at 300 K. $\Delta G^0$ for the reaction is ($R = 2$ cal / mol K)
↻ Repeated question — also appeared in
2023 (7 sets)
- A. -13.73 cal
- B. 1372.60 cal
- C. -137.26 cal
- D. -1381.80 cal
Correct answer & explanation hidden
Log in to view solution →
Q90
CHEMISTRY
Unit 12: Coordination Compounds
Which complex compound is most stable?
- A. $[Co(NH_3)_6]_2(SO_4)_3$
- B. $[Co(NH_3)_4(H_2O)Br](NO_3)_2$
- C. $[Co(NH_3)_3(NO_3)_3]$
- D. $[CoCl_2(en)_2]NO_3$
Correct answer & explanation hidden
Log in to view solution →
Q91
CHEMISTRY
Unit 4: Chemical Thermodynamics
Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
↻ Repeated question — also appeared in
2023 (6 sets)
- A. $\Delta H + \Delta U = \Delta n R$
- B. $\Delta H = \Delta U - \Delta n_g RT$
- C. $\Delta H = \Delta U + \Delta n_g RT$
- D. $\Delta H - \Delta U = -\Delta n RT$
Correct answer & explanation hidden
Log in to view solution →
Q92
PHYSICS
Unit 7: Properties of Solids and Liquids
What fraction of one edge centred octahedral void lies in one unit cell of fcc?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 1/12
- B. 1/2
- C. 1/3
- D. 1/4
Correct answer & explanation hidden
Log in to view solution →
Q97
BIOLOGY
Unit 10: Ecology and Environment
Given below are two statements:
Statement I: The nutrient deficient water bodies lead to eutrophication.
Statement II: Eutrophication leads to decrease in the level of oxygen in the water bodies.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Statement I is incorrect but Statement II is true.
- B. Both Statement I and Statement II are true.
- C. Both Statement I and Statement II are false.
- D. Statement I is correct but Statement II is false.
Correct answer & explanation hidden
Log in to view solution →
Q98
CHEMISTRY
Unit 11: d- and f-Block Elements
The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. CaO + SiO_2 -> CaSiO_3
- B. Fe_2O_3 + CO -> 2FeO + CO_2
- C. FeO + CO -> Fe + CO_2
- D. C + CO_2 -> 2CO
Correct answer & explanation hidden
Log in to view solution →
Q99
CHEMISTRY
Unit 5: Solutions
Pumice stone is an example of -
↻ Repeated question — also appeared in
2023 (8 sets)
- A. foam
- B. sol
- C. gel
- D. solid sol
Correct answer & explanation hidden
Log in to view solution →
Q99
CHEMISTRY
Unit 5: Solutions
Pumice stone is an example of -
↻ Repeated question — also appeared in
2023 (8 sets)
- A. foam
- B. sol
- C. gel
- D. solid sol
Correct answer & explanation hidden
Log in to view solution →
Q101
CHEMISTRY
Unit 19: Biomolecules
Cellulose does not form blue colour with Iodine because
↻ Repeated question — also appeared in
2023 (7 sets)
- A. It breakes down when iodine reacts with it.
- B. It is a disaccharide.
- C. It is a helical molecule.
- D. It does not contain complex helices and hence cannot hold iodine molecules.
Correct answer & explanation hidden
Log in to view solution →
Q102
BIOLOGY
Unit 6: Reproduction
In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Synergids, antipodals and Polar nuclei
- B. Synergids, Primary endosperm nucleus and zygote
- C. Antipodals, synergids, and primary endosperm nucleus
- D. Synergids, Zygote and Primary endosperm nucleus
Correct answer & explanation hidden
Log in to view solution →
Q103
BIOLOGY
Unit 1: Diversity in Living World
Identify the pair of heterosporous pteridophytes among the following :
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Equisetum and Salvinia
- B. Lycopodium and Selaginella
- C. Selaginella and Salvinia
- D. Psilotum and Salvinia
Correct answer & explanation hidden
Log in to view solution →
Q105
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Axile placentation is observed in
↻ Repeated question — also appeared in
2023 (5 sets)
- A. China rose, Petunia and Lemon
- B. Mustard, Cucumber and Primrose
- C. China rose, Beans and Lupin
- D. Tomato, Dianthus and Pea
Correct answer & explanation hidden
Log in to view solution →
Q106
BIOLOGY
Unit 4: Plant Physiology
Which micronutrient is required for splitting of water molecule during photosynthesis?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. copper
- B. manganese
- C. molybdenum
- D. magnesium
Correct answer & explanation hidden
Log in to view solution →
Q107
BIOLOGY
Unit 10: Ecology and Environment
In the equation GPP - R = NPP, GPP is Gross Primary Productivity, NPP is Net Primary Productivity, R here is _________
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Reproductive allocation
- B. Photosynthetically active radiation
- C. Respiratory quotient
- D. Respiratory loss
Correct answer & explanation hidden
Log in to view solution →
Q108
BIOLOGY
Unit 4: Plant Physiology
Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Abscisic Acid
- B. Indole-3-butyric Acid
- C. Gibberellic Acid
- D. Zeatin
Correct answer & explanation hidden
Log in to view solution →
Q109
BIOLOGY
Unit 4: Plant Physiology
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Senescence
- B. Differentiation
- C. Dedifferentiation
- D. Development
Correct answer & explanation hidden
Log in to view solution →
Q110
BIOLOGY
Unit 7: Genetics and Evolution
The phenomenon of pleiotropism refers to
↻ Repeated question — also appeared in
2023 (7 sets)
- A. more than two genes affecting a single character.
- B. presence of several alleles of a single gene controlling a single crossover.
- C. presence of two alleles, each of the two genes controlling a single trait.
- D. a single gene affecting multiple phenotypic expression.
Correct answer & explanation hidden
Log in to view solution →
Q111
BIOLOGY
Unit 3: Cell Structure and Function
Which of the following stages of meiosis involves division of centromere?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Telophase
- B. Metaphase I
- C. Metaphase II
- D. Anaphase II
Correct answer & explanation hidden
Log in to view solution →
Q112
BIOLOGY
Unit 7: Genetics and Evolution
Unequivocal proof that DNA is the genetic material was first proposed by
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Wilkins and Franklin
- B. Frederick Griffith
- C. Alfred Hershey and Martha Chase
- D. Avery, Macleoid and McCarthy
Correct answer & explanation hidden
Log in to view solution →
Q112
BIOLOGY
Unit 7: Genetics and Evolution
Unequivocal proof that DNA is the genetic material was first proposed by
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Wilkins and Franklin
- B. Frederick Griffith
- C. Alfred Hershey and Martha Chase
- D. Avery, Macleoid and McCarthy
Correct answer & explanation hidden
Log in to view solution →
Q113
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: Late wood has fewer xylary elements with narrow vessels.
Reason R: Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true but R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q114
BIOLOGY
Unit 1: Diversity in Living World
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R: Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. A is not correct but R is correct.
- B. Both A and R are correct and R is the correct explanation of A.
- C. Both A and R are correct but R is NOT the correct explanation of A.
- D. A is correct but R is not correct.
Correct answer & explanation hidden
Log in to view solution →
Q115
BIOLOGY
Unit 4: Plant Physiology
The reaction centre in PS II has an absorption maxima at
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 780 nm
- B. 680 nm
- C. 700 nm
- D. 660 nm
Correct answer & explanation hidden
Log in to view solution →
Q116
BIOLOGY
Unit 10: Ecology and Environment
The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 2002
- B. 1985
- C. 1992
- D. 1986
Correct answer & explanation hidden
Log in to view solution →
Q117
BIOLOGY
Unit 3: Cell Structure and Function
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Transcription of only snRNAs
- B. Transcription of rRNAs (28S, 18S and 5.8S)
- C. Transcription of tRNA, 5S rRNA and snRNA
- D. Transcription of precursor of mRNA
Correct answer & explanation hidden
Log in to view solution →
Q118
BIOLOGY
Unit 6: Reproduction
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
↻ Repeated question — also appeared in
2023 (4 sets)
- A. Diakinesis
- B. Zygotene
- C. Pachytene
- D. Diplotene
Correct answer & explanation hidden
Log in to view solution →
Q119
BIOLOGY
Unit 4: Plant Physiology
Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Active Transport
- B. Osmosis
- C. Facilitated Diffusion
- D. Passive Transport
Correct answer & explanation hidden
Log in to view solution →
Q120
BIOLOGY
Unit 9: Biotechnology and Its Applications
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Bright orange colour
- B. Bright red colour
- C. Bright blue colour
- D. Bright yellow colour
Correct answer & explanation hidden
Log in to view solution →
Q121
BIOLOGY
Unit 1: Diversity in Living World
Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
↻ Repeated question — also appeared in
2023 (5 sets)
- A. Epiphyllous and Dithecous anthers
- B. Diadelphous and Dithecous anthers
- C. Polyadelphous and epipetalous stamens
- D. Monoadelphous and Monothecous anthers
Correct answer & explanation hidden
Log in to view solution →
Q122
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Given below are two statements:
Statement I: Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II: Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Statement I is incorrect but Statement II is true.
- B. Both Statement I and Statement II are true.
- C. Both Statement I and Statement II are false.
- D. Statement I is correct but Statement II is false.
Correct answer & explanation hidden
Log in to view solution →
Q123
BIOLOGY
Unit 7: Genetics and Evolution
Expressed Sequence Tags (ESTs) refers to
↻ Repeated question — also appeared in
2023 (4 sets)
- A. Certain important expressed genes.
- B. All genes that are expressed as RNA.
- C. All genes that are expressed as proteins.
- D. All genes whether expressed or unexpressed.
Correct answer & explanation hidden
Log in to view solution →
Q124
BIOLOGY
Unit 4: Plant Physiology
Which hormone promotes internode/petiole elongation in deep water rice?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 2, 4-D
- B. GA3
- C. Kinetin
- D. Ethylene
Correct answer & explanation hidden
Log in to view solution →
Q125
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
What is the function of tassels in the corn cob?
↻ Repeated question — also appeared in
2023 (3 sets)
- A. To protect seeds
- B. To attract insects
- C. To trap pollen grains
- D. To disperse pollen grains
Correct answer & explanation hidden
Log in to view solution →
Q126
BIOLOGY
Unit 4: Plant Physiology
Given below are two statements:
Statement I: The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II: Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Statement I is incorrect but Statement II is correct.
- B. Both Statement I and Statement II are correct.
- C. Both Statement I and Statement II are incorrect.
- D. Statement I is correct but Statement II is incorrect.
Correct answer & explanation hidden
Log in to view solution →
Q126
BIOLOGY
Unit 4: Plant Physiology
Given below are two statements :
Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below :
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Statement I is incorrect but Statement II is correct.
- B. Both Statement I and Statement II are correct.
- C. Both Statement I and Statement II are incorrect.
- D. Statement I is correct but Statement II is incorrect.
Correct answer & explanation hidden
Log in to view solution →
Q127
BIOLOGY
Unit 9: Biotechnology and Its Applications
During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Polysaccharides
- B. RNA
- C. DNA
- D. Histones
Correct answer & explanation hidden
Log in to view solution →
Q127
BIOLOGY
Unit 9: Biotechnology and Its Applications
During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Polysaccharides
- B. RNA
- C. DNA
- D. Histones
Correct answer & explanation hidden
Log in to view solution →
Q128
BIOLOGY
Unit 7: Genetics and Evolution
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Henking
- B. Thomas Hunt Morgan
- C. Sutton and Boveri
- D. Alfred Sturtevant
Correct answer & explanation hidden
Log in to view solution →
Q128
BIOLOGY
Unit 7: Genetics and Evolution
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Henking
- B. Thomas Hunt Morgan
- C. Sutton and Boveri
- D. Alfred Sturtevant
Correct answer & explanation hidden
Log in to view solution →
Q129
BIOLOGY
Unit 10: Ecology and Environment
Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Co-extinctions
- B. Habitat loss and fragmentation
- C. Over exploitation for economic gain
- D. Alien species invasions
Correct answer & explanation hidden
Log in to view solution →
Q130
BIOLOGY
Unit 4: Plant Physiology
How many ATP and NADPH$_2$ are required for the synthesis of one molecule of Glucose during Calvin cycle?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. 18 ATP and 16 NADPH$_2$
- B. 12 ATP and 12 NADPH$_2$
- C. 18 ATP and 12 NADPH$_2$
- D. 12 ATP and 16 NADPH$_2$
Correct answer & explanation hidden
Log in to view solution →
Q131
BIOLOGY
Unit 6: Reproduction
Large, colourful, fragrant flowers with nectar are seen in :
↻ Repeated question — also appeared in
2023 (6 sets)
- A. wind pollinated plants
- B. insect pollinated plants
- C. bird pollinated plants
- D. bat pollinated plants
Correct answer & explanation hidden
Log in to view solution →
Q132
BIOLOGY
Unit 3: Cell Structure and Function
Among eukaryotes, replication of DNA takes place in -
↻ Repeated question — also appeared in
2023 (8 sets)
- A. G$_2$ phase
- B. M phase
- C. S phase
- D. G$_1$ phase
Correct answer & explanation hidden
Log in to view solution →
Q133
BIOLOGY
Unit 10: Ecology and Environment
The thickness of ozone in a column of air in the atmosphere is measured in terms of :
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Kilo base
- B. Dobson units
- C. Decibels
- D. Decameter
Correct answer & explanation hidden
Log in to view solution →
Q134
BIOLOGY
Unit 4: Plant Physiology
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : ATP is used at two steps in glycolysis.
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true but R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q135
BIOLOGY
Unit 9: Biotechnology and Its Applications
In gene gun method used to introduce alien DNA into host cells, microparticles of
____ metal are used.
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Silver
- B. Copper
- C. Zinc
- D. Tungsten or gold
Correct answer & explanation hidden
Log in to view solution →
Q136
BIOLOGY
Unit 4: Plant Physiology
Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Dinitrogenase
- B. Succinic dehydrogenase
- C. Amylase
- D. Lipase
Correct answer & explanation hidden
Log in to view solution →
Q139
BIOLOGY
Unit 10: Ecology and Environment
Which one of the following statements is NOT correct?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels.
- B. The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms.
- C. Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.
- D. Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body.
Correct answer & explanation hidden
Log in to view solution →
Q139
BIOLOGY
Unit 10: Ecology and Environment
Which one of the following statements is NOT correct?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels.
- B. The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms.
- C. Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.
- D. Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body.
Correct answer & explanation hidden
Log in to view solution →
Q140
BIOLOGY
Unit 4: Plant Physiology
Which of the following combinations is required for chemiosmosis?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. proton pump, electron gradient, NADP synthase
- B. membrane, proton pump, proton gradient, ATP synthase
- C. membrane, proton pump, proton gradient, NADP synthase
- D. proton pump, electron gradient, ATP synthase
Correct answer & explanation hidden
Log in to view solution →
Q140
BIOLOGY
Unit 4: Plant Physiology
Which of the following combinations is required for chemiosmosis?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. proton pump, electron gradient, NADP synthase
- B. membrane, proton pump, proton gradient, ATP synthase
- C. membrane, proton pump, proton gradient, NADP synthase
- D. proton pump, electron gradient, ATP synthase
Correct answer & explanation hidden
Log in to view solution →
Q141
BIOLOGY
Unit 7: Genetics and Evolution
Which of the following statements are correct about Klinefelter's Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A and E only
- B. A and B only
- C. C and D only
- D. B and E only
Correct answer & explanation hidden
Log in to view solution →
Q142
BIOLOGY
Unit 10: Ecology and Environment
Match List I with List II:
List I (Interaction) | List II (Species A and B)
A. Mutualism | I. + (A), O(B)
B. Commensalism | II. -(A), O(B)
C. Amensalism | III. + (A), -(B)
D. Parasitism | IV. +(A),+(B)
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A-III, B-I, C-IV, D-II
- B. A-IV, B-II, C-I, D-III
- C. A-IV, B-I, C-II, D-III
- D. A-IV, B-III, C-I, D-II
Correct answer & explanation hidden
Log in to view solution →
Q143
BIOLOGY
Unit 4: Plant Physiology
Match List I with List II:
List I | List II
A. Cohesion | I. More attraction in liquid phase
B. Adhesion | II. Mutual attraction among water molecules
C. Surface tension | III. Water loss in liquid phase
D. Guttation | IV. Attraction towards polar surfaces
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A-II, B-I, C-IV, D-III
- B. A-II, B-IV, C-I, D-III
- C. A-IV, B-III, C-II, D-I
- D. A-III, B-I, C-IV, D-II
Correct answer & explanation hidden
Log in to view solution →
Q144
BIOLOGY
Unit 3: Cell Structure and Function
Match List I with List II:
List I | List II
A. M Phase | I. Proteins are synthesized
B. G2 Phase | II. Inactive phase
C. Quiescent stage | III. Interval between mitosis and initiation of DNA replication
D. G1 Phase | IV. Equational division
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A-II, B-IV, C-I, D-III
- B. A-III, B-II, C-IV, D-I
- C. A-IV, B-II, C-I, D-III
- D. A-IV, B-I, C-II, D-III
Correct answer & explanation hidden
Log in to view solution →
Q145
BIOLOGY
Unit 1: Diversity in Living World
Given below are two statements: Assertion A: In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason R: Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true but R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q146
BIOLOGY
Unit 9: Biotechnology and Its Applications
Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.
A. Insertion of recombinant DNA into the host cell.
B. Cutting of DNA at specific location by restriction enzyme.
C. Isolation of desired DNA fragment.
D. Amplification of gene of interest using PCR.
↻ Repeated question — also appeared in
2023 (8 sets)
- A. B, D, A, C
- B. B, C, D, A
- C. C, A, B, D
- D. C, B, D, A
Correct answer & explanation hidden
Log in to view solution →
Q146
BIOLOGY
Unit 9: Biotechnology and Its Applications
Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.
A. Insertion of recombinant DNA into the host cell.
B. Cutting of DNA at specific location by restriction enzyme.
C. Isolation of desired DNA fragment.
D. Amplification of gene of interest using PCR.
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. B, D, A, C
- B. B, C, D, A
- C. C, A, B, D
- D. C, B, D, A
Correct answer & explanation hidden
Log in to view solution →
Q147
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Given below are two statements: Assertion A: A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem. Reason R: Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves.
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true but R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q148
BIOLOGY
Unit 4: Plant Physiology
Match List I with List II:
List I | List II
A. Oxidative decarboxylation | I. Citrate synthase
B. Glycolysis | II. Pyruvate dehydrogenase
C. Oxidative phosphorylation | III. Electron transport system
D. Tricarboxylic acid cycle | IV. EMP pathway
↻ Repeated question — also appeared in
2023 (1 set)
- A. A-II, B-IV, C-III, D-I
- B. A-III, B-IV, C-II, D-I
- C. A-II, B-III, C-I, D-III
- D. A-III, B-I, C-II, D-IV
Correct answer & explanation hidden
Log in to view solution →
Q148
BIOLOGY
Unit 4: Plant Physiology
Match List I with List II:
List I (Process) | List II (Associated Enzyme/Pathway)
A. Oxidative decarboxylation | I. Citrate synthase
B. Glycolysis | II. Pyruvate dehydrogenase
C. Oxidative phosphorylation | III. Electron transport system
D. Tricarboxylic acid cycle | IV. EMP pathway
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. A-II, B-IV, C-III, D-I
- B. A-III, B-IV, C-II, D-I
- C. A-II, B-IV, C-I, D-III
- D. A-III, B-I, C-II, D-IV
Correct answer & explanation hidden
Log in to view solution →
Q149
BIOLOGY
Unit 10: Ecology and Environment
Given below are two statements:
Statement I: Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II: In general, carnivores are more adversely affected by competition than herbivores.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Statement I is incorrect but Statement II is true.
- B. Both Statement I and Statement II are true.
- C. Both Statement I and Statement II are false.
- D. Statement I is correct but Statement II is false.
Correct answer & explanation hidden
Log in to view solution →
Q150
BIOLOGY
Unit 3: Cell Structure and Function
How many different proteins does the ribosome consist of?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. 20
- B. 80
- C. 60
- D. 40
Correct answer & explanation hidden
Log in to view solution →
Q151
BIOLOGY
Unit 9: Biotechnology and Its Applications
Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
↻ Repeated question — also appeared in
2023 (5 sets)
- A. Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
- B. Recombinant DNA Technology
- C. Serum and Urine analysis
- D. Polymerase Chain Reaction (PCR) technique
Correct answer & explanation hidden
Log in to view solution →
Q152
BIOLOGY
Unit 6: Reproduction
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.
Reason R: Ban on amniocentesis checks increasing menace of female foeticide.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true and R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q153
BIOLOGY
Unit 10: Ecology and Environment
Match List I with List II.
List I (Interacting species) | List II (Name of Interaction)
A. A Leopard and a Lion in a forest/grassland | I. Competition
B. A Cuckoo laying egg in a Crow's nest | II. Brood parasitism
C. Fungi and root of a higher plant in Mycorrhizae | III. Mutualism
D. A cattle egret and a Cattle in a field | IV. Commensalism
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. A-II, B-III, C-I, D-IV
- B. A-I, B-II, C-III, D-IV
- C. A-I, B-II, C-IV, D-III
- D. A-III, B-IV, C-I, D-II
Correct answer & explanation hidden
Log in to view solution →
Q154
BIOLOGY
Unit 7: Genetics and Evolution
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Lemur, Anteater, Wolf
- B. Tasmanian wolf, Bobcat, Marsupial mole
- C. Numbat, Spotted cuscus, Flying phalanger
- D. Mole, Flying squirrel, Tasmanian tiger cat
Correct answer & explanation hidden
Log in to view solution →
Q155
BIOLOGY
Unit 5: Human Physiology
Match List I with List II.
List I (Type of Joint) | List II (Found between)
A. Cartilaginous Joint | I. Between flat skull bones
B. Ball and Socket Joint | II. Between adjacent vertebrae in vertebral column
C. Fibrous Joint | III. Between carpal and metacarpal of thumb
D. Saddle Joint | IV. Between Humerus and Pectoral girdle
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. A-II, B-IV, C-III, D-I
- B. A-III, B-I, C-II, D-IV
- C. A-II, B-IV, C-I, D-III
- D. A-I, B-IV, C-III, D-II
Correct answer & explanation hidden
Log in to view solution →
Q155
BIOLOGY
Unit 5: Human Physiology
Match List I with List II.
| List I (Type of Joint) | List II (Found between) |
| :--- | :--- |
| A. Cartilaginous Joint | I. Between flat skull bones |
| B. Ball and Socket Joint | II. Between adjacent vertebrae in vertebral column |
| C. Fibrous Joint | III. Between carpal and metacarpal of thumb |
| D. Saddle Joint | IV. Between Humerus and Pectoral girdle |
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. A-II, B-IV, C-III, D-I
- B. A-III, B-I, C-II, D-IV
- C. A-II, B-IV, C-I, D-III
- D. A-I, B-IV, C-III, D-II
Correct answer & explanation hidden
Log in to view solution →
Q156
BIOLOGY
Unit 5: Human Physiology
Match List I with List II.
List I (Cells) | List II (Secretion)
A. Peptic cells | I. Mucus
B. Goblet cells | II. Bile juice
C. Oxyntic cells | III. Proenzyme pepsinogen
D. Hepatic cells | IV. HCl and intrinsic factor for absorption of vitamin B12
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A-II, B-IV, C-I, D-III
- B. A-IV, B-III, C-II, D-I
- C. A-II, B-I, C-III, D-IV
- D. A-III, B-I, C-IV, D-II
Correct answer & explanation hidden
Log in to view solution →
Q156
BIOLOGY
Unit 5: Human Physiology
Match List I with List II.
| List I (Cells) | List II (Secretion) |
| :--- | :--- |
| A. Peptic cells | I. Mucus |
| B. Goblet cells | II. Bile juice |
| C. Oxyntic cells | III. Proenzyme pepsinogen |
| D. Hepatic cells | IV. HCl and intrinsic factor for absorption of vitamin $B_{12}$ |
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A-II, B-IV, C-I, D-III
- B. A-IV, B-III, C-II, D-I
- C. A-II, B-I, C-III, D-IV
- D. A-III, B-I, C-IV, D-II
Correct answer & explanation hidden
Log in to view solution →
Q157
BIOLOGY
Unit 7: Genetics and Evolution
Broad palm with single palm crease is visible in a person suffering from-
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Thalassemia
- B. Down's syndrome
- C. Turner's syndrome
- D. Klinefelter's syndrome
Correct answer & explanation hidden
Log in to view solution →
Q157
BIOLOGY
Unit 7: Genetics and Evolution
Broad palm with single palm crease is visible in a person suffering from-
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Thalassemia
- B. Down's syndrome
- C. Turner's syndrome
- D. Klinefelter's syndrome
Correct answer & explanation hidden
Log in to view solution →
Q158
BIOLOGY
Unit 8: Biology and Human Welfare
Match List I with List II.
| List I | List II |
| :--- | :--- |
| A. Ringworm | I. Haemophilus influenzae |
| B. Filariasis | II. Trichophyton |
| C. Malaria | III. Wuchereria bancrofti |
| D. Pneumonia | IV. Plasmodium vivax |
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. A-III, B-II, C-IV, D-I
- B. A-II, B-III, C-IV, D-I
- C. A-II, B-III, C-I, D-IV
- D. A-III, B-II, C-I, D-IV
Correct answer & explanation hidden
Log in to view solution →
Q159
BIOLOGY
Unit 7: Genetics and Evolution
Match List I with List II.
| List I | List II |
| :--- | :--- |
| A. Gene 'a' | I. $\beta$-galactosidase |
| B. Gene 'y' | II. Transacetylase |
| C. Gene 'i' | III. Permease |
| D. Gene 'z' | IV. Repressor protein |
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A-III, B-I, C-IV, D-II
- B. A-II, B-I, C-IV, D-III
- C. A-II, B-III, C-IV, D-I
- D. A-III, B-IV, C-I, D-II
Correct answer & explanation hidden
Log in to view solution →
Q160
BIOLOGY
Unit 3: Cell Structure and Function
Given below are two statements:
Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal).
Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of $\alpha$ type and two subunits of $\beta$ type.)
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (1 set)
- A. Statement I is false but Statement II is true.
- B. Both Statement I and Statement II are true.
- C. Both Statement I and Statement II are false.
- D. Statement I is true but Statement II is false.
Correct answer & explanation hidden
Log in to view solution →
Q161
BIOLOGY
Unit 8: Biology and Human Welfare
Match List I with List II.
| List I | List II |
| :--- | :--- |
| A. Heroin | I. Effect on cardiovascular system |
| B. Marijuana | II. Slow down body function |
| C. Cocaine | III. Painkiller |
| D. Morphine | IV. Interfere with transport of dopamine |
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. A-III, B-IV, C-I, D-II
- B. A-II, B-I, C-IV, D-III
- C. A-I, B-II, C-III, D-IV
- D. A-IV, B-III, C-II, D-I
Correct answer & explanation hidden
Log in to view solution →
Q162
BIOLOGY
Unit 6: Reproduction
Which of the following statements are correct regarding female reproductive cycle?
A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B. First menstrual cycle begins at puberty and is called menopause.
C. Lack of menstruation may be indicative of pregnancy.
D. Cyclic menstruation extends between menarche and menopause.
Choose the most appropriate answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. A, C and D only
- B. A and D only
- C. A and B only
- D. A, B and C only
Correct answer & explanation hidden
Log in to view solution →
Q164
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Match List I with List II.
| List I | List II |
| :--- | :--- |
| A. Taenia | I. Nephridia |
| B. Paramoecium | II. Contractile vacuole |
| C. Periplaneta | III. Flame cells |
| D. Pheretima | IV. Urecose gland |
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (3 sets)
- A. A-II, B-I, C-IV, D-III
- B. A-I, B-II, C-III, D-IV
- C. A-I, B-II, C-IV, D-III
- D. A-III, B-II, C-IV, D-I
Correct answer & explanation hidden
Log in to view solution →
Q165
BIOLOGY
Unit 1: Diversity in Living World
Radial symmetry is NOT found in adults of phylum _________
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Echinodermata
- B. Ctenophora
- C. Hemichordata
- D. Coelenterata
Correct answer & explanation hidden
Log in to view solution →
Q165
BIOLOGY
Unit 1: Diversity in Living World
Radial symmetry is NOT found in adults of phylum ________.
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Echinodermata
- B. Ctenophora
- C. Hemichordata
- D. Coelenterata
Correct answer & explanation hidden
Log in to view solution →
Q166
BIOLOGY
Unit 8: Biology and Human Welfare
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Eosinophils
- B. TH cells
- C. B-lymphocytes
- D. Basophils
Correct answer & explanation hidden
Log in to view solution →
Q166
BIOLOGY
Unit 5: Human Physiology
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
- A. Eosinophils
- B. TH cells
- C. B-lymphocytes
- D. Basophils
Correct answer & explanation hidden
Log in to view solution →
Q167
BIOLOGY
Unit 10: Ecology and Environment
Which of the following statements is correct?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Algal Bloom decreases fish mortality
- B. Eutrophication refers to increase in domestic sewage and waste water in lakes.
- C. Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.
- D. Presence of large amount of nutrients in water restricts 'Algal Bloom'
Correct answer & explanation hidden
Log in to view solution →
Q167
BIOLOGY
Unit 10: Ecology and Environment
Which of the following statements is correct?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Algal Bloom decreases fish mortality
- B. Eutrophication refers to increase in domestic sewage and waste water in lakes.
- C. Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.
- D. Presence of large amount of nutrients in water restricts 'Algal Bloom'
Correct answer & explanation hidden
Log in to view solution →
Q168
BIOLOGY
Unit 8: Biology and Human Welfare
Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
↻ Repeated question — also appeared in
2023 (2 sets)
- A. HIV Infection
- B. Genital herpes
- C. Gonorrhoea
- D. Hepatitis-B
Correct answer & explanation hidden
Log in to view solution →
Q168
BIOLOGY
Unit 6: Reproduction
Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
↻ Repeated question — also appeared in
2023 (3 sets)
- A. HIV Infection
- B. Genital herpes
- C. Gonorrhoea
- D. Hepatitis-B
Correct answer & explanation hidden
Log in to view solution →
Q171
BIOLOGY
Unit 7: Genetics and Evolution
Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Statement I incorrect but Statement II is true.
- B. Both Statement I and Statement II are true.
- C. Both Statement I and Statement II are false.
- D. Statement I is correct but Statement II is false.
Correct answer & explanation hidden
Log in to view solution →
Q172
BIOLOGY
Unit 5: Human Physiology
Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by-
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Pyloric sphincter
- B. Sphincter of Oddi
- C. Ileo-caecal valve
- D. Gastro-oesophageal sphincter
Correct answer & explanation hidden
Log in to view solution →
Q173
BIOLOGY
Unit 10: Ecology and Environment
Given below are two statements:
Statement I: Electrostatic precipitator is most widely used in thermal power plant.
Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations.
In the light of the above statements, choose the most appropriate answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Statement I incorrect but Statement II is correct.
- B. Both Statement I and Statement II are correct.
- C. Both Statement I and Statement II are incorrect.
- D. Statement I is correct but Statement II is incorrect.
Correct answer & explanation hidden
Log in to view solution →
Q174
BIOLOGY
Unit 5: Human Physiology
Given below are statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla.
Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true but R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q175
BIOLOGY
Unit 3: Cell Structure and Function
Which of the following functions is carried out by cytoskeleton in a cell?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Transportation
- B. Nuclear division
- C. Protein synthesis
- D. Motility
Correct answer & explanation hidden
Log in to view solution →
Q175
BIOLOGY
Unit 3: Cell Structure and Function
Which of the following functions is carried out by cytoskeleton in a cell?
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Transportation
- B. Nuclear division
- C. Protein synthesis
- D. Motility
Correct answer & explanation hidden
Log in to view solution →
Q176
BIOLOGY
Unit 7: Genetics and Evolution
Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Statement I false but Statement II is true.
- B. Both Statement I and Statement II are true.
- C. Both Statement I and Statement II are false.
- D. Statement I is true but Statement II is false.
Correct answer & explanation hidden
Log in to view solution →
Q176
BIOLOGY
Unit 7: Genetics and Evolution
Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (8 sets)
- A. Statement I false but Statement II is true.
- B. Both Statement I and Statement II are true.
- C. Both Statement I and Statement II are false.
- D. Statement I is true but Statement II is false.
Correct answer & explanation hidden
Log in to view solution →
Q177
BIOLOGY
Unit 5: Human Physiology
Vital capacity of lung is _________.
↻ Repeated question — also appeared in
2023 (7 sets)
- A. IRV+ ERV+ TV
- B. IRV+ ERV
- C. IRV+ ERV+ TV+ RV
- D. IRV + ERV + TV - RV
Correct answer & explanation hidden
Log in to view solution →
Q178
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Given below are two statements:
Statement I: Ligaments are dense irregular tissue.
Statement II: Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Statement I is false but Statement II is true.
- B. Both Statement I and Statement II are true.
- C. Both Statement I and Statement II are false.
- D. Statement I is true but Statement II is false.
Correct answer & explanation hidden
Log in to view solution →
Q179
BIOLOGY
Unit 5: Human Physiology
Match List I with List II:
List I: A. P-wave, B. Q-wave, C. QRS complex, D. T-wave
List II: I. Beginning of systole, II. Repolarisation of ventricles, III. Depolarisation of atria, IV. Depolarisation of ventricles
- A. A-I, B-II, C-III, D-IV
- B. A-III, B-I, C-IV, D-II
- C. A-IV, B-III, C-II, D-I
- D. A-II, B-IV, C-I, D-III
Correct answer & explanation hidden
Log in to view solution →
Q180
BIOLOGY
Unit 9: Biotechnology and Its Applications
Which of the following is not a cloning vector?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Probe
- B. BAC
- C. YAC
- D. pBR322
Correct answer & explanation hidden
Log in to view solution →
Q181
BIOLOGY
Unit 3: Cell Structure and Function
Given below are two statements:
Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Statement I is false but Statement II is true.
- B. Both Statement I and Statement II are true.
- C. Both Statement I and Statement II are false.
- D. Statement I is true but Statement II is false.
Correct answer & explanation hidden
Log in to view solution →
Q182
BIOLOGY
Unit 6: Reproduction
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Endometrium is necessary for implantation of blastocyst.
Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.
In the light of the above statements, choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (4 sets)
- A. A is false but R is true.
- B. Both A and R are true and R is the correct explanation of A.
- C. Both A and R are true but R is NOT the correct explanation of A.
- D. A is true but R is false.
Correct answer & explanation hidden
Log in to view solution →
Q183
BIOLOGY
Unit 3: Cell Structure and Function
Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic Reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A, D and E only
- B. B and D only
- C. A, C and E only
- D. A and D only
Correct answer & explanation hidden
Log in to view solution →
Q184
BIOLOGY
Unit 5: Human Physiology
Match List I with List II:
List I: A. CCK, B. GIP, C. ANF, D. ADH
List II: I. Kidney, II. Heart, III. Gastric gland, IV. Pancreas
- A. A-IV, B-II, C-III, D-I
- B. A-IV, B-III, C-II, D-I
- C. A-III, B-II, C-IV, D-I
- D. A-II, B-IV, C-I, D-III
Correct answer & explanation hidden
Log in to view solution →
Q185
BIOLOGY
Unit 6: Reproduction
Match List I with List II:
List I: A. Vasectomy, B. Coitus interruptus, C. Cervical caps, D. Saheli
List II: I. Oral method, II. Barrier method, III. Surgical method, IV. Natural method
- A. A-IV, B-II, C-I, D-III
- B. A-III, B-I, C-IV, D-II
- C. A-III, B-IV, C-II, D-I
- D. A-II, B-III, C-I, D-IV
Correct answer & explanation hidden
Log in to view solution →
Q186
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Match List I with List II:
List I: A. Mast cells, B. Inner surface of bronchiole, C. Blood, D. Tubular parts of nephron
List II: I. Ciliated epithelium, II. Areolar connective tissue, III. Cuboidal epithelium, IV. specialised connective tissue
- A. A-III, B-IV, C-II, D-I
- B. A-I, B-II, C-IV, D-III
- C. A-II, B-III, C-I, D-IV
- D. A-II, B-I, C-IV, D-III
Correct answer & explanation hidden
Log in to view solution →
Q186
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Match List I with List II.
List I | List II
A. Mast cells | I. Ciliated epithelium
B. Inner surface of bronchiole | II. Areolar connective tissue
C. Blood | III. Cuboidal epithelium
D. Tubular parts of nephron | IV. Specialised connective tissue
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (3 sets)
- A. A-III, B-IV, C-II, D-I
- B. A-I, B-II, C-IV, D-III
- C. A-II, B-III, C-I, D-IV
- D. A-II, B-I, C-IV, D-III
Correct answer & explanation hidden
Log in to view solution →
Q187
BIOLOGY
Unit 8: Biology and Human Welfare
Which one of the following is NOT an advantage of inbreeding?
↻ Repeated question — also appeared in
2023 (7 sets)
- A. It decreases the productivity of inbred population, after continuous inbreeding.
- B. It decreases homozygosity.
- C. It exposes harmful recessive genes that are eliminated by selection.
- D. Elimination of less desirable genes and accumulation of superior genes takes place due to it.
Correct answer & explanation hidden
Log in to view solution →
Q188
BIOLOGY
Unit 5: Human Physiology
Which of the following are NOT under the control of thyroid hormone?
A. Maintenance of water and electrolyte balance
B. Regulation of basal metabolic rate
C. Normal rhythm of sleep-wake cycle
D. Development of immune system
E. Support the process of R.B.Cs formation
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. D and E only
- B. A and D only
- C. B and C only
- D. C and D only
Correct answer & explanation hidden
Log in to view solution →
Q189
BIOLOGY
Unit 5: Human Physiology
Which of the following statements are correct?
A. Basophils are most abundant cells of the total WBCs
B. Basophils secrete histamine, serotonin and heparin
C. Basophils are involved in inflammatory response
D. Basophils have kidney shaped nucleus
E. Basophils are agranulocytes
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. A and B only
- B. D and E only
- C. C and E only
- D. B and C only
Correct answer & explanation hidden
Log in to view solution →
Q190
BIOLOGY
Unit 5: Human Physiology
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are:
↻ Repeated question — also appeared in
2023 (7 sets)
- A. Corpus callosum and thalamus
- B. Limbic system & hypothalamus
- C. Corpora quadrigemina & hippocampus
- D. Brain stem & epithalamus
Correct answer & explanation hidden
Log in to view solution →
Q191
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
↻ Repeated question — also appeared in
2023 (6 sets)
- A. Presence of anal cerci
- B. Dark brown body colour and anal cerci
- C. Presence of anal styles
- D. Presence of sclerites
Correct answer & explanation hidden
Log in to view solution →
Q192
BIOLOGY
Unit 7: Genetics and Evolution
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
↻ Repeated question — also appeared in
2023 (6 sets)
- A. 3' ATCGATCGATCGATCGATCGATCGATCG 5'
- B. 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
- C. 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'
- D. 5' ATCGATCGATCGATCGATCGATCGATCG 3'
Correct answer & explanation hidden
Log in to view solution →
Q193
BIOLOGY
Unit 2: Structural Organisation in Animals and Plants
In cockroach, excretion is brought about by:
A. Phallic gland B. Urecose gland
C. Nephrocytes D. Fat body
E. Collaterial glands
Choose the correct answer from the options given below:
↻ Repeated question — also appeared in
2023 (5 sets)
- A. B and D only
- B. A and E only
- C. A, B and E only
- D. B, C and D only
Correct answer & explanation hidden
Log in to view solution →
Q194
BIOLOGY
Unit 1: Diversity in Living World
The unique mammalian characteristics are:
↻ Repeated question — also appeared in
2023 (6 sets)
- A. pinna, monocondylic skull and mammary glands
- B. hairs, tympanic membrane and mammary glands
- C. hairs, pinna and mammary glands
- D. hairs, pinna and indirect development
Correct answer & explanation hidden
Log in to view solution →