NEET-H1-2023 — NEET 2023 Question Paper with Solutions

Q1 PHYSICS Unit 5: Rotational Motion

The ratio of radius of gyration of a solid sphere of mass $M$ and radius $R$ about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is:

↻ Repeated question — also appeared in 2023 (7 sets)

A. 2:5
B. 5:2
C. 3:5
D. 5:3

Correct answer & explanation hidden

Log in to view solution →

Q1 PHYSICS Unit 5: Rotational Motion

The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :

↻ Repeated question — also appeared in 2023 (7 sets)

A. 2:5
B. 5:2
C. 3:5
D. 5:3

Correct answer & explanation hidden

Log in to view solution →

Q2 PHYSICS Unit 14: Electromagnetic Induction and Alternating Currents

The magnetic energy stored in an inductor of inductance $4\,\mu\text{H}$ carrying a current of $2\,\text{A}$ is:

↻ Repeated question — also appeared in 2023 (2 sets)

A. 8 mJ
B. 8 µJ
C. 4 µJ
D. 4 mJ

Correct answer & explanation hidden

Log in to view solution →

Q3 PHYSICS Unit 19: Electronic Devices

A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?

↻ Repeated question — also appeared in 2023 (8 sets)

A. Capacitor
B. Load resistance
C. A centre-tapped transformer
D. p-n junction diodes

Correct answer & explanation hidden

Log in to view solution →

Q4 PHYSICS Unit 11: Electrostatics

An electric dipole is placed at an angle of 30° with an electric field of intensity $2 \times 10^5 \text{ N C}^{-1}$. It experiences a torque equal to 4 N m. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.

↻ Repeated question — also appeared in 2023 (8 sets)

A. 4 mC
B. 2 mC
C. 8 mC
D. 6 mC

Correct answer & explanation hidden

Log in to view solution →

Q6 PHYSICS Unit 18: Atoms and Nuclei

In hydrogen spectrum, the shortest wavelength in the Balmer series is $\lambda$. The shortest wavelength in the Brackett series is :

↻ Repeated question — also appeared in 2023 (6 sets)

A. 9/16 \lambda
B. 16/9 \lambda
C. 2 \lambda
D. 4 \lambda

Correct answer & explanation hidden

Log in to view solution →

Q7 PHYSICS Unit 12: Current Electricity

Resistance of a carbon resistor determined from colour codes is $(22000 \pm 5\%) \Omega$. The colour of third band must be :

↻ Repeated question — also appeared in 2023 (6 sets)

A. Orange
B. Yellow
C. Red
D. Green

Correct answer & explanation hidden

Log in to view solution →

Q8 PHYSICS Unit 6: Gravitation

Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be (G = gravitational constant) :

↻ Repeated question — also appeared in 2023 (6 sets)

A. -16 Gm / R
B. -20 Gm / R
C. -8 Gm / R
D. -12 Gm / R

Correct answer & explanation hidden

Log in to view solution →

Q11 PHYSICS Unit 7: Properties of Solids and Liquids

The venturi-meter works on:

↻ Repeated question — also appeared in 2023 (7 sets)

A. The principle of parallel axes
B. The principle of perpendicular axes
C. Huygen's principle
D. Bernoulli's principle

Correct answer & explanation hidden

Log in to view solution →

Q12 PHYSICS Unit 7: Properties of Solids and Liquids

Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is :

↻ Repeated question — also appeared in 2023 (8 sets)

A. W/2A
B. Zero
C. 2W/A
D. W/A

Correct answer & explanation hidden

Log in to view solution →

Q13 PHYSICS Unit 5: Rotational Motion

The angular acceleration of a body, moving along the circumference of a circle, is :

↻ Repeated question — also appeared in 2023 (6 sets)

A. along the tangent to its position
B. along the axis of rotation
C. along the radius, away from centre
D. along the radius towards the centre

Correct answer & explanation hidden

Log in to view solution →

Q14 PHYSICS Unit 9: Kinetic Theory of Gases

The temperature of a gas is -50° C. To what temperature the gas should be heated so that the rms speed is increased by 3 times?

↻ Repeated question — also appeared in 2023 (7 sets)

A. 3097 K
B. 223 K
C. 669° C
D. 3295° C

Correct answer & explanation hidden

Log in to view solution →

Q16 PHYSICS Unit 14: Electromagnetic Induction and Alternating Currents

An ac source is connected to a capacitor C. Due to decrease in its operating frequency :

↻ Repeated question — also appeared in 2023 (6 sets)

A. displacement current decreases.
B. capacitive reactance remains constant
C. capacitive reactance decreases.
D. displacement current increases.

Correct answer & explanation hidden

Log in to view solution →

Q19 PHYSICS Unit 14: Electromagnetic Induction and Alternating Currents

A 12 V, 60 W lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?

↻ Repeated question — also appeared in 2023 (7 sets)

A. 3.7 A
B. 0.37 A
C. 0.27 A
D. 2.7 A

Correct answer & explanation hidden

Log in to view solution →

Q20 PHYSICS Unit 1: Physics and Measurement

A metal wire has mass $(0.4 \pm 0.002) \text{ g}$, radius $(0.3 \pm 0.001) \text{ mm}$ and length $(5 \pm 0.02) \text{ cm}$. The maximum possible percentage error in the measurement of density will nearly be:

↻ Repeated question — also appeared in 2023 (7 sets)

A. 1.6%
B. 1.4%
C. 1.2%
D. 1.3%

Correct answer & explanation hidden

Log in to view solution →

Q21 PHYSICS Unit 19: Electronic Devices

Given below are two statements: Statement I : Photovoltaic devices can convert optical radiation into electricity. Statement II : Zener diode is designed to operate under reverse bias in breakdown region. In the light of the above statements, choose the most appropriate answer from the options given below :

↻ Repeated question — also appeared in 2023 (6 sets)

A. Statement I is correct but Statement II is incorrect.
B. Statement I is incorrect but Statement II is correct.
C. Both Statement I and Statement II are correct.
D. Both Statement I and Statement II are incorrect.

Correct answer & explanation hidden

Log in to view solution →

Q23 PHYSICS Unit 8: Thermodynamics

A Carnot engine has an efficiency of 50% when its source is at a temperature $327^\circ \text{C}$. The temperature of the sink is :

↻ Repeated question — also appeared in 2023 (8 sets)

A. 100° C
B. 200° C
C. 27° C
D. 15° C

Correct answer & explanation hidden

Log in to view solution →

Q24 PHYSICS Unit 7: Properties of Solids and Liquids

The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly : (surface tension of soap solution = 0.03 $\text{N m}^{-1}$)

↻ Repeated question — also appeared in 2023 (8 sets)

A. 3.01 x 10^-4 J
B. 50.1 x 10^-4 J
C. 30.16 x 10^-4 J
D. 5.06 x 10^-4 J

Correct answer & explanation hidden

Log in to view solution →

Q25 PHYSICS Unit 17: Dual Nature of Matter and Radiation

The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to:

↻ Repeated question — also appeared in 2023 (3 sets)

A. 1/sqrt(V)
B. V^2
C. sqrt(V)
D. 1/V

Correct answer & explanation hidden

Log in to view solution →

Q26 PHYSICS Unit 14: Electromagnetic Induction and Alternating Currents

In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 µF and resistance R is 100 Ω. The frequency at which resonance occurs is :

↻ Repeated question — also appeared in 2023 (7 sets)

A. 1.59 rad/s
B. 1.59 kHz
C. 15.9 rad/s
D. 15.9 kHz

Correct answer & explanation hidden

Log in to view solution →

Q27 PHYSICS Unit 4: Work Energy and Power

The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential energy stored in it will be :

↻ Repeated question — also appeared in 2023 (8 sets)

A. 8U
B. 16U
C. 2U
D. 4U

Correct answer & explanation hidden

Log in to view solution →

Q28 PHYSICS Unit 18: Atoms and Nuclei

The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to (1/16)th of its initial value?

↻ Repeated question — also appeared in 2023 (8 sets)

A. 60 minutes
B. 80 minutes
C. 20 minutes
D. 40 minutes

Correct answer & explanation hidden

Log in to view solution →

Q29 PHYSICS Unit 11: Electrostatics

If $\oint_S \vec{E} \cdot d\vec{S} = 0$ over a surface, then :

↻ Repeated question — also appeared in 2023 (8 sets)

A. all the charges must necessarily be inside the surface.
B. the electric field inside the surface is necessarily uniform.
C. the number of flux lines entering the surface must be equal to the number of flux lines leaving it.
D. the magnitude of electric field on the surface is constant.

Correct answer & explanation hidden

Log in to view solution →

Q30 PHYSICS Unit 10: Oscillations and Waves

The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is :

↻ Repeated question — also appeared in 2023 (7 sets)

A. 1 : 3
B. 3 : 1
C. 1 : 2
D. 2 : 1

Correct answer & explanation hidden

Log in to view solution →

Q31 PHYSICS Unit 1: Physics and Measurement

The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :

↻ Repeated question — also appeared in 2023 (5 sets)

A. Least count errors
B. Random errors
C. Instrumental errors
D. Personal errors

Correct answer & explanation hidden

Log in to view solution →

Q32 PHYSICS Unit 15: Electromagnetic Waves

In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of $2.0 \times 10^{10} \text{ Hz}$ and amplitude $48 \text{ Vm}^{-1}$. Then the amplitude of oscillating magnetic field is : (Speed of light in free space $= 3 \times 10^8 \text{ m s}^{-1}$)

↻ Repeated question — also appeared in 2023 (9 sets)

A. 1.6 x 10^-7 T
B. 1.6 x 10^-6 T
C. 1.6 x 10^-9 T
D. 1.6 x 10^-8 T

Correct answer & explanation hidden

Log in to view solution →

Q32 PHYSICS Unit 15: Electromagnetic Waves

In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of $2.0 \times 10^{10} \text{ Hz}$ and amplitude $48 \text{ Vm}^{-1}$. Then the amplitude of oscillating magnetic field is: (Speed of light in free space = $3 \times 10^8 \text{ m s}^{-1}$)

↻ Repeated question — also appeared in 2023 (9 sets)

A. $1.6 \times 10^{-7} \text{ T}$
B. $1.6 \times 10^{-6} \text{ T}$
C. $1.6 \times 10^{-9} \text{ T}$
D. $1.6 \times 10^{-8} \text{ T}$

Correct answer & explanation hidden

Log in to view solution →

Q35 PHYSICS Unit 2: Kinematics

A vehicle travels half the distance with speed $v$ and the remaining distance with speed $2v$. Its average speed is:

↻ Repeated question — also appeared in 2023 (5 sets)

A. $4v/3$
B. $3v/4$
C. $v/3$
D. $2v/3$

Correct answer & explanation hidden

Log in to view solution →

Q36 PHYSICS Unit 18: Atoms and Nuclei

The radius of inner most orbit of hydrogen atom is $5.3 \times 10^{-11} \text{ m}$. What is the radius of third allowed orbit of hydrogen atom?

↻ Repeated question — also appeared in 2023 (8 sets)

A. $1.59 \text{ Å}$
B. $4.77 \text{ Å}$
C. $0.53 \text{ Å}$
D. $1.06 \text{ Å}$

Correct answer & explanation hidden

Log in to view solution →

Q38 PHYSICS Unit 10: Oscillations and Waves

The $x-t$ graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at $t = 2 \text{ s}$ is:

↻ Repeated question — also appeared in 2023 (4 sets)

A. $\frac{\pi^2}{16} \text{ m s}^{-2}$
B. $-\frac{\pi^2}{16} \text{ m s}^{-2}$
C. $\frac{\pi^2}{8} \text{ m s}^{-2}$
D. $-\frac{\pi^2}{8} \text{ m s}^{-2}$

Correct answer & explanation hidden

Log in to view solution →

Q39 PHYSICS Unit 16: Optics

Two thin lenses are of same focal lengths ($f$), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be:

↻ Repeated question — also appeared in 2023 (6 sets)

A. $f/2$
B. Infinite
C. Zero
D. $f/4$

Correct answer & explanation hidden

Log in to view solution →

Q40 PHYSICS Unit 6: Gravitation

A satellite is orbiting just above the surface of the earth with period $T$. If $d$ is the density of the earth and $G$ is the universal constant of gravitation, the quantity $\frac{3\pi}{Gd}$ represents:

↻ Repeated question — also appeared in 2023 (6 sets)

A. $T^3$
B. $\sqrt{T}$
C. $T$
D. $T^2$

Correct answer & explanation hidden

Log in to view solution →

Q41 PHYSICS Unit 3: Laws of Motion

Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is $0.15$ ($g = 10 \text{ m s}^{-2}$).

↻ Repeated question — also appeared in 2023 (6 sets)

A. $1.5 \text{ m s}^{-2}$
B. $50 \text{ m s}^{-2}$
C. $1.2 \text{ m s}^{-2}$
D. $150 \text{ m s}^{-2}$

Correct answer & explanation hidden

Log in to view solution →

Q43 PHYSICS Unit 14: Electromagnetic Induction and Alternating Currents

The net impedance of circuit (as shown in figure) will be:

↻ Repeated question — also appeared in 2023 (5 sets)

A. $5\sqrt{5} \text{ Ω}$
B. $25 \text{ Ω}$
C. $10\sqrt{2} \text{ Ω}$
D. $15 \text{ Ω}$

Correct answer & explanation hidden

Log in to view solution →

Q44 PHYSICS Unit 19: Electronic Devices

For the following logic circuit, the truth table is:

↻ Repeated question — also appeared in 2023 (4 sets)

A. A=0,B=0,Y=1; A=0,B=1,Y=0; A=1,B=0,Y=1; A=1,B=1,Y=0
B. A=0,B=0,Y=0; A=0,B=1,Y=0; A=1,B=0,Y=0; A=1,B=1,Y=1
C. A=0,B=0,Y=1; A=0,B=1,Y=1; A=1,B=0,Y=0; A=1,B=1,Y=0
D. A=0,B=0,Y=0; A=0,B=1,Y=1; A=1,B=0,Y=1; A=1,B=1,Y=1

Correct answer & explanation hidden

Log in to view solution →

Q46 PHYSICS Unit 2: Kinematics

A bullet from a gun is fired on a rectangular wooden block with velocity $u$. When the bullet travels 24 cm through the block along its length horizontally, its velocity becomes $u/3$. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is:

A. 28 cm
B. 30 cm
C. 27 cm
D. 24 cm

Correct answer & explanation hidden

Log in to view solution →

Q47 PHYSICS Unit 12: Current Electricity

The resistance of platinum wire at $0°C$ is $2Ω$ and $6.8Ω$ at $80°C$. The temperature coefficient of resistance of the wire is:

↻ Repeated question — also appeared in 2023 (5 sets)

A. $3 \times 10^{-2} °C^{-1}$
B. $3 \times 10^{-1} °C^{-1}$
C. $3 \times 10^{-4} °C^{-1}$
D. $3 \times 10^{-3} °C^{-1}$

Correct answer & explanation hidden

Log in to view solution →

Q47 PHYSICS Unit 12: Current Electricity

The resistance of platinum wire at 0°C is $2\, \Omega$ and $6.8\, \Omega$ at 80°C. The temperature coefficient of resistance of the wire is:

↻ Repeated question — also appeared in 2023 (5 sets)

A. $3 \times 10^{-2}\, ^\circ \text{C}^{-1}$
B. $3 \times 10^{-1}\, ^\circ \text{C}^{-1}$
C. $3 \times 10^{-4}\, ^\circ \text{C}^{-1}$
D. $3 \times 10^{-3}\, ^\circ \text{C}^{-1}$

Correct answer & explanation hidden

Log in to view solution →

Q48 PHYSICS Unit 2: Kinematics

A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity $4 \text{ m s}^{-1}$. The ball strikes the water surface after $4 \text{ s}$. The height of bridge above water surface is (Take $g = 10 \text{ m s}^{-2}$):

↻ Repeated question — also appeared in 2023 (9 sets)

A. $64 \text{ m}$
B. $68 \text{ m}$
C. $56 \text{ m}$
D. $60 \text{ m}$

Correct answer & explanation hidden

Log in to view solution →

Q48 PHYSICS Unit 2: Kinematics

A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity $4\, \text{m s}^{-1}$. The ball strikes the water surface after $4\, \text{s}$. The height of the bridge above the water surface is (Take $g = 10\, \text{m s}^{-2}$):

↻ Repeated question — also appeared in 2023 (9 sets)

A. 64 m
B. 68 m
C. 56 m
D. 60 m

Correct answer & explanation hidden

Log in to view solution →

Q51 CHEMISTRY Unit 8: Chemical Kinetics

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: A reaction can have zero activation energy. Reason R: The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (6 sets)

A. A is true but R is false.
B. A is false but R is true.
C. Both A and R are true and R is the correct explanation of A.
D. Both A and R are true and R is NOT the correct explanation of A.

Correct answer & explanation hidden

Log in to view solution →

Q55 CHEMISTRY Unit 1: Some Basic Concepts in Chemistry

The right option for the mass of $\text{CO}_2$ produced by heating 20 g of 20% pure limestone is (Atomic mass of Ca = 40). $$\text{CaCO}_3 \xrightarrow{1200\, \text{K}} \text{CaO} + \text{CO}_2$$

↻ Repeated question — also appeared in 2023 (7 sets)

A. 2.64 g
B. 1.32 g
C. 1.12 g
D. 1.76 g

Correct answer & explanation hidden

Log in to view solution →

Q56 CHEMISTRY Unit 2: Atomic Structure

The relation between $n_m$ ($n_m$ = the number of permissible values of magnetic quantum number ($m$)) for a given value of azimuthal quantum number ($l$), is

↻ Repeated question — also appeared in 2023 (6 sets)

A. $n_m = 2l^2 + 1$
B. $n_m = l + 2$
C. $l = (n_m - 1) / 2$
D. $l = 2n_m + 1$

Correct answer & explanation hidden

Log in to view solution →

Q58 CHEMISTRY Unit 8: Chemical Kinetics

Which one is an example of heterogenous catalysis?

↻ Repeated question — also appeared in 2023 (7 sets)

A. Decomposition of ozone in presence of nitrogen monoxide.
B. Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron.
C. Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen.
D. Hydrolysis of sugar catalysed by H+ ions.

Correct answer & explanation hidden

Log in to view solution →

Q59 CHEMISTRY Unit 15: Hydrocarbons

Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is:

↻ Repeated question — also appeared in 2023 (5 sets)

A. 30
B. 18
C. 16
D. 32

Correct answer & explanation hidden

Log in to view solution →

Q60 CHEMISTRY Unit 3: Chemical Bonding and Molecular Structure

The number of $\sigma$ bonds, $\pi$ bonds and lone pair of electrons in pyridine, respectively are:

↻ Repeated question — also appeared in 2023 (2 sets)

A. 11, 3, 1
B. 12, 2, 1
C. 11, 2, 0
D. 12, 3, 0

Correct answer & explanation hidden

Log in to view solution →

Q60 CHEMISTRY Unit 14: Some Basic Principles of Organic Chemistry

The number of $\sigma$ bonds, $\pi$ bonds and lone pair of electrons in pyridine, respectively are:

↻ Repeated question — also appeared in 2023 (2 sets)

A. 11, 3, 1
B. 12, 2, 1
C. 11, 2, 0
D. 12, 3, 0

Correct answer & explanation hidden

Log in to view solution →

Q62 CHEMISTRY Unit 11: d- and f-Block Elements

The stability of $Cu^{2+}$ is more than $Cu^+$ salts in aqueous solution due to -

↻ Repeated question — also appeared in 2023 (8 sets)

A. hydration energy.
B. second ionisation enthalpy.
C. first ionisation enthalpy.
D. enthalpy of atomization.

Correct answer & explanation hidden

Log in to view solution →

Q65 CHEMISTRY Unit 10: p-Block Elements

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: Helium is used to dilute oxygen in diving apparatus. Reasons R: Helium has high solubility in $O_2$. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (2 sets)

A. A is true but R is false.
B. A is false but R is true.
C. Both A and R are true and R is the correct explanation of A.
D. Both A and R are true and R is NOT the correct explanation of A.

Correct answer & explanation hidden

Log in to view solution →

Q69 CHEMISTRY Unit 11: d- and f-Block Elements

Taking stability as the factor, which one of the following represents correct relationship?

A. AlCl > $AlCl_3$
B. TlI > $TlI_3$
C. $TlCl_3$ > TlCl
D. $InI_3$ > InI

Correct answer & explanation hidden

Log in to view solution →

Q72 CHEMISTRY Unit 10: p-Block Elements

Match List - I with List - II : List - I | List - II --- | --- A. Coke | I. Carbon atoms are $sp^3$ hybridised. B. Diamond | II. Used as a dry lubricant C. Fullerene | III. Used as a reducing agent D. Graphite | IV. Cage like molecules Choose the correct answer from the options given below :

↻ Repeated question — also appeared in 2023 (1 set)

A. (1) A-III, B-I, C-IV, D-II
B. (2) A-III, B-IV, C-I, D-II
C. (3) A-II, B-IV, C-I, D-III
D. (4) A-IV, B-I, C-II, D-III

Correct answer & explanation hidden

Log in to view solution →

Q73 CHEMISTRY Unit 10: p-Block Elements

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic. Reasons R: The deep blue solution is due to the formation of amide. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (3 sets)

A. A is true but R is false.
B. A is false but R is true.
C. Both A and R are true and R is the correct explanation of A.
D. Both A and R are true but R is NOT the correct explanation of A.

Correct answer & explanation hidden

Log in to view solution →

Q73 CHEMISTRY Unit 10: p-Block Elements

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic. Reasons R : The deep blue solution is due to the formation of amide. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (3 sets)

A. (1) A is true but R is false.
B. (2) A is false but R is true.
C. (3) Both A and R are true and R is the correct explanation of A.
D. (4) Both A and R are true but R is NOT the correct explanation of A.

Correct answer & explanation hidden

Log in to view solution →

Q76 CHEMISTRY Unit 13: Purification and Characterisation of Organic Compounds

In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with $Fe^{3+}$ due to the formation of -

↻ Repeated question — also appeared in 2023 (4 sets)

A. (1) $[Fe(CN)_5NOS]^{4-}$
B. (2) $[Fe(SCN)]^{2+}$
C. (3) $Fe_4[Fe(CN)_6]_3 \cdot xH_2O$
D. (4) NaSCN

Correct answer & explanation hidden

Log in to view solution →

Q78 CHEMISTRY Unit 3: Chemical Bonding and Molecular Structure

Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is $NH_3, AlCl_3, BeCl_2, CCl_4, PCl_5$

↻ Repeated question — also appeared in 2023 (7 sets)

A. (1) 4
B. (2) 1
C. (3) 3
D. (4) 2

Correct answer & explanation hidden

Log in to view solution →

Q79 PHYSICS Unit 7: Properties of Solids and Liquids

A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is $A_xB_y$, then the value of $x + y$ is in option

↻ Repeated question — also appeared in 2023 (4 sets)

A. (1) 3
B. (2) 2
C. (3) 5
D. (4) 4

Correct answer & explanation hidden

Log in to view solution →

Q81 CHEMISTRY Unit 19: Biomolecules

Some tranquilizers are listed below. Which one from the following belongs to barbiturates?

↻ Repeated question — also appeared in 2023 (3 sets)

A. (1) Valium
B. (2) Veronal
C. (3) Chlordiazepoxide
D. (4) Meprobamate

Correct answer & explanation hidden

Log in to view solution →

Q82 CHEMISTRY Unit 7: Redox Reactions and Electrochemistry

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : In equation $\Delta_rG = -nFE_{cell}$, value of $\Delta_rG$ depends on n. Reasons R : $E_{cell}$ is an intensive property and $\Delta_rG$ is an extensive property. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (6 sets)

A. (1) A is true but R is false.
B. (2) A is false but R is true.
C. (3) Both A and R are true and R is the correct explanation of A.
D. (4) Both A and R are true but R is NOT the correct explanation of A.

Correct answer & explanation hidden

Log in to view solution →

Q83 CHEMISTRY Unit 19: Biomolecules

Given below are two statements : Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside Statement II : When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (6 sets)

A. (1) Statement I is true but Statement II is false.
B. (2) Statement I is false but Statement II is true.
C. (3) Both Statement I and Statement II are true.
D. (4) Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q83 CHEMISTRY Unit 19: Biomolecules

Given below are two statements: Statement I: A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside. Statement II: When nucleoside is linked to phosphorous acid at 5'-position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (6 sets)

A. Statement I is true but Statement II is false.
B. Statement I is false but Statement II is true.
C. Both Statement I and Statement II are true.
D. Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q84 CHEMISTRY Unit 8: Chemical Kinetics

For a certain reaction, the rate = $k [A]^2 [B]$, when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would

↻ Repeated question — also appeared in 2023 (8 sets)

A. (1) increase by a factor of nine.
B. (2) increase by a factor of three.
C. (3) decrease by a factor of nine.
D. (4) increase by a factor of six.

Correct answer & explanation hidden

Log in to view solution →

Q84 CHEMISTRY Unit 8: Chemical Kinetics

For a certain reaction, the rate $= k[A]^2[B]$. When the initial concentration of A is tripled keeping concentration of B constant, the initial rate would:

↻ Repeated question — also appeared in 2023 (8 sets)

A. increase by a factor of nine.
B. increase by a factor of three.
C. decrease by a factor of nine.
D. increase by a factor of six.

Correct answer & explanation hidden

Log in to view solution →

Q85 CHEMISTRY Unit 3: Chemical Bonding and Molecular Structure

Amongst the given options which of the following molecules / ion acts as a Lewis acid?

↻ Repeated question — also appeared in 2023 (2 sets)

A. (1) $BF_3$
B. (2) $OH^-$
C. (3) $NH_3$
D. (4) $H_2O$

Correct answer & explanation hidden

Log in to view solution →

Q87 PHYSICS Unit 7: Properties of Solids and Liquids

What fraction of one edge centred octahedral void lies in one unit cell of fcc?

↻ Repeated question — also appeared in 2023 (7 sets)

A. 1/4
B. 1/12
C. 1/2
D. 1/3

Correct answer & explanation hidden

Log in to view solution →

Q91 PHYSICS Unit 8: Thermodynamics

Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?

↻ Repeated question — also appeared in 2023 (1 set)

A. $\Delta H - \Delta U = -\Delta n_gRT$
B. $\Delta H + \Delta U = \Delta nRT$
C. $\Delta H = \Delta U - \Delta n_gRT$
D. $\Delta H = \Delta U + \Delta n_gRT$

Correct answer & explanation hidden

Log in to view solution →

Q92 BIOLOGY Unit 10: Ecology and Environment

Given below are two statements: Statement I: The nutrient deficient water bodies lead to eutrophication. Statement II: Eutrophication leads to decrease in the level of oxygen in the water bodies. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (8 sets)

A. Statement I is correct but Statement II is false.
B. Statement I is incorrect but Statement II is true.
C. Both Statement I and Statement II are true.
D. Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q93 CHEMISTRY Unit 5: Solutions

Pumice stone is an example of:

↻ Repeated question — also appeared in 2023 (7 sets)

A. solid sol
B. foam
C. sol
D. gel

Correct answer & explanation hidden

Log in to view solution →

Q95 CHEMISTRY Unit 11: d- and f-Block Elements

The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is:

↻ Repeated question — also appeared in 2023 (6 sets)

A. $C + CO_2 \to 2CO$
B. $CaO + SiO_2 \to CaSiO_3$
C. $Fe_2O_3 + CO \to 2FeO + CO_2$
D. $FeO + CO \to Fe + CO_2$

Correct answer & explanation hidden

Log in to view solution →

Q96 CHEMISTRY Unit 6: Equilibrium

The equilibrium concentrations of the species in the reaction $A + B \rightleftharpoons C + D$ are 2, 3, 10 and 6 mol $L^{-1}$, respectively at 300 K. $\Delta G^0$ for the reaction is (R = 2 cal / mol K):

↻ Repeated question — also appeared in 2023 (6 sets)

A. -1381.80 cal
B. -13.73 cal
C. 1372.60 cal
D. -137.26 cal

Correct answer & explanation hidden

Log in to view solution →

Q100 CHEMISTRY Unit 7: Redox Reactions and Electrochemistry

On balancing the given redox reaction, $a Cr_2O_7^{2-} + b SO_3^{2-} (aq) + c H^+ (aq) \to 2a Cr^{3+} (aq) + b SO_4^{2-} (aq) + \frac{c}{2} H_2O(l)$, the coefficients a, b and c are found to be, respectively:

↻ Repeated question — also appeared in 2023 (4 sets)

A. 1, 8, 3
B. 8, 1, 3
C. 1, 3, 8
D. 3, 8, 1

Correct answer & explanation hidden

Log in to view solution →

Q101 BIOLOGY Unit 2: Structural Organisation in Animals and Plants

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Late wood has fewer xylary elements with narrow vessels. Reason R : Cambium is less active in winters. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (6 sets)

A. A is true but R is false.
B. A is false but R is true.
C. Both A and R are true and R is the correct explanation of A.
D. Both A and R are true but R is NOT the correct explanation of A.

Correct answer & explanation hidden

Log in to view solution →

Q102 BIOLOGY Unit 10: Ecology and Environment

The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year :

↻ Repeated question — also appeared in 2023 (8 sets)

A. 1986
B. 2002
C. 1985
D. 1992

Correct answer & explanation hidden

Log in to view solution →

Q103 BIOLOGY Unit 10: Ecology and Environment

In the equation $GPP - R = NPP$, GPP is Gross Primary Productivity NPP is Net Primary Productivity R here is -----

↻ Repeated question — also appeared in 2023 (8 sets)

A. Respiratory loss
B. Reproductive allocation
C. Photosynthetically active radiation
D. Respiratory quotient

Correct answer & explanation hidden

Log in to view solution →

Q104 BIOLOGY Unit 4: Plant Physiology

What is the function of tassels in the corn cob?

↻ Repeated question — also appeared in 2023 (1 set)

A. To disperse pollen grains
B. To protect seeds
C. To attract insects
D. To trap pollen grains

Correct answer & explanation hidden

Log in to view solution →

Q105 BIOLOGY Unit 3: Cell Structure and Function

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

↻ Repeated question — also appeared in 2023 (6 sets)

A. Transcription of precursor of mRNA
B. Transcription of only snRNAs
C. Transcription of rRNAs (28S, 18S and 5.8S)
D. Transcription of tRNA, 5S rRNA and snRNA

Correct answer & explanation hidden

Log in to view solution →

Q106 BIOLOGY Unit 9: Biotechnology and Its Applications

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

↻ Repeated question — also appeared in 2023 (7 sets)

A. Bright yellow colour
B. Bright orange colour
C. Bright red colour
D. Bright blue colour

Correct answer & explanation hidden

Log in to view solution →

Q107 BIOLOGY Unit 10: Ecology and Environment

The thickness of ozone in a column of air in the atmosphere is measured in terms of :

↻ Repeated question — also appeared in 2023 (8 sets)

A. Decameter
B. Kilo base
C. Dobson units
D. Decibels

Correct answer & explanation hidden

Log in to view solution →

Q108 BIOLOGY Unit 7: Genetics and Evolution

The phenomenon of pleiotropism refers to

↻ Repeated question — also appeared in 2023 (7 sets)

A. a single gene affecting multiple phenotypic expression.
B. more than two genes affecting a single character.
C. presence of several alleles of a single gene controlling a single crossover.
D. presence of two alleles, each of the two genes controlling a single trait.

Correct answer & explanation hidden

Log in to view solution →

Q109 BIOLOGY Unit 4: Plant Physiology

Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?

↻ Repeated question — also appeared in 2023 (8 sets)

A. Zeatin
B. Abscisic Acid
C. Indole-3-butyric Acid
D. Gibberellic Acid

Correct answer & explanation hidden

Log in to view solution →

Q110 BIOLOGY Unit 1: Diversity in Living World

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage. Reason R : Protonema develops directly from spores produced in capsule. In the light of the above statements, choose the most appropriate answer from the options given below :

↻ Repeated question — also appeared in 2023 (6 sets)

A. A is correct but R is not correct.
B. A is not correct but R is correct.
C. Both A and R are correct and R is the correct explanation of A.
D. Both A and R are correct but R is NOT the correct explanation of A.

Correct answer & explanation hidden

Log in to view solution →

Q111 BIOLOGY Unit 9: Biotechnology and Its Applications

During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out

↻ Repeated question — also appeared in 2023 (8 sets)

A. Histones
B. Polysaccharides
C. RNA
D. DNA

Correct answer & explanation hidden

Log in to view solution →

Q111 BIOLOGY Unit 9: Biotechnology and Its Applications

During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out

↻ Repeated question — also appeared in 2023 (8 sets)

A. Histones
B. Polysaccharides
C. RNA
D. DNA

Correct answer & explanation hidden

Log in to view solution →

Q112 BIOLOGY Unit 4: Plant Physiology

The reaction centre in PS II has an absorption maxima at

↻ Repeated question — also appeared in 2023 (8 sets)

A. 660 nm
B. 780 nm
C. 680 nm
D. 700 nm

Correct answer & explanation hidden

Log in to view solution →

Q112 BIOLOGY Unit 4: Plant Physiology

The reaction centre in PS II has an absorption maxima at

↻ Repeated question — also appeared in 2023 (8 sets)

A. 660 nm
B. 780 nm
C. 680 nm
D. 700 nm

Correct answer & explanation hidden

Log in to view solution →

Q113 BIOLOGY Unit 1: Diversity in Living World

Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.

↻ Repeated question — also appeared in 2023 (5 sets)

A. Monoadelphous and Monothecous anthers
B. Epiphyllous and Dithecous anthers
C. Diadelphous and Dithecous anthers
D. Polyadelphous and epipetalous stamens

Correct answer & explanation hidden

Log in to view solution →

Q113 BIOLOGY Unit 2: Structural Organisation in Animals and Plants

Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.

↻ Repeated question — also appeared in 2023 (4 sets)

A. Monoadelphous and Monothecous anthers
B. Epiphyllous and Dithecous anthers
C. Diadelphous and Dithecous anthers
D. Polyadelphous and epipetalous stamens

Correct answer & explanation hidden

Log in to view solution →

Q114 BIOLOGY Unit 4: Plant Physiology

Which micronutrient is required for splitting of water molecule during photosynthesis?

↻ Repeated question — also appeared in 2023 (8 sets)

A. magnesium
B. copper
C. manganese
D. molybdenum

Correct answer & explanation hidden

Log in to view solution →

Q114 BIOLOGY Unit 4: Plant Physiology

Which micronutrient is required for splitting of water molecule during photosynthesis?

↻ Repeated question — also appeared in 2023 (8 sets)

A. magnesium
B. copper
C. manganese
D. molybdenum

Correct answer & explanation hidden

Log in to view solution →

Q115 BIOLOGY Unit 10: Ecology and Environment

Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?

↻ Repeated question — also appeared in 2023 (8 sets)

A. Alien species invasions
B. Co-extinctions
C. Habitat loss and fragmentation
D. Over exploitation for economic gain

Correct answer & explanation hidden

Log in to view solution →

Q115 BIOLOGY Unit 10: Ecology and Environment

Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?

↻ Repeated question — also appeared in 2023 (8 sets)

A. Alien species invasions
B. Co-extinctions
C. Habitat loss and fragmentation
D. Over exploitation for economic gain

Correct answer & explanation hidden

Log in to view solution →

Q116 BIOLOGY Unit 4: Plant Physiology

Movement and accumulation of ions across a membrane against their concentration gradient can be explained by

↻ Repeated question — also appeared in 2023 (9 sets)

A. Passive Transport
B. Active Transport
C. Osmosis
D. Facilitated Diffusion

Correct answer & explanation hidden

Log in to view solution →

Q116 BIOLOGY Unit 4: Plant Physiology

Movement and accumulation of ions across a membrane against their concentration gradient can be explained by

↻ Repeated question — also appeared in 2023 (9 sets)

A. Passive Transport
B. Active Transport
C. Osmosis
D. Facilitated Diffusion

Correct answer & explanation hidden

Log in to view solution →

Q117 BIOLOGY Unit 4: Plant Physiology

In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as -

↻ Repeated question — also appeared in 2023 (6 sets)

A. Development
B. Senescence
C. Differentiation
D. Dedifferentiation

Correct answer & explanation hidden

Log in to view solution →

Q118 BIOLOGY Unit 6: Reproduction

The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?

↻ Repeated question — also appeared in 2023 (4 sets)

A. Diplotene
B. Diakinesis
C. Zygotene
D. Pachytene

Correct answer & explanation hidden

Log in to view solution →

Q119 BIOLOGY Unit 4: Plant Physiology

Given below are two statements : Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height. Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling. In the light of the above statements, choose the most appropriate answer from the options given below :

↻ Repeated question — also appeared in 2023 (7 sets)

A. Statement I is correct but Statement II is incorrect.
B. Statement I is incorrect but Statement II is correct.
C. Both Statement I and Statement II are correct.
D. Both Statement I and Statement II are incorrect.

Correct answer & explanation hidden

Log in to view solution →

Q120 BIOLOGY Unit 2: Structural Organisation in Animals and Plants

Axile placentation is observed in

↻ Repeated question — also appeared in 2023 (5 sets)

A. Tomato, Dianthus and Pea
B. China rose, Petunia and Lemon
C. Mustard, Cucumber and Primrose
D. China rose, Beans and Lupin

Correct answer & explanation hidden

Log in to view solution →

Q121 BIOLOGY Unit 6: Reproduction

Which of the following stages of meiosis involves division of centromere?

↻ Repeated question — also appeared in 2023 (1 set)

A. Anaphase II
B. Telophase
C. Metaphase I
D. Metaphase II

Correct answer & explanation hidden

Log in to view solution →

Q122 BIOLOGY Unit 7: Genetics and Evolution

Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by

↻ Repeated question — also appeared in 2023 (7 sets)

A. Alfred Sturtevant
B. Henking
C. Thomas Hunt Morgan
D. Sutton and Boveri

Correct answer & explanation hidden

Log in to view solution →

Q123 CHEMISTRY Unit 19: Biomolecules

Cellulose does not form blue colour with Iodine because

↻ Repeated question — also appeared in 2023 (7 sets)

A. It does not contain complex helices and hence cannot hold iodine molecules.
B. It breakes down when iodine reacts with it.
C. It is a disaccharide.
D. It is a helical molecule.

Correct answer & explanation hidden

Log in to view solution →

Q124 BIOLOGY Unit 9: Biotechnology and Its Applications

In gene gun method used to introduce alien DNA into host cells, microparticles of ____ metal are used.

↻ Repeated question — also appeared in 2023 (7 sets)

A. Tungsten or gold
B. Silver
C. Copper
D. Zinc

Correct answer & explanation hidden

Log in to view solution →

Q125 BIOLOGY Unit 1: Diversity in Living World

Identify the pair of heterosporous pteridophytes among the following :

↻ Repeated question — also appeared in 2023 (7 sets)

A. Psilotum and Salvinia
B. Equisetum and Salvinia
C. Lycopodium and Selaginella
D. Selaginella and Salvinia

Correct answer & explanation hidden

Log in to view solution →

Q126 BIOLOGY Unit 7: Genetics and Evolution

Unequivocal proof that DNA is the genetic material was first proposed by

↻ Repeated question — also appeared in 2023 (7 sets)

A. Avery, Macleoid and McCarthy
B. Wilkins and Franklin
C. Frederick Griffith
D. Alfred Hershey and Martha Chase

Correct answer & explanation hidden

Log in to view solution →

Q127 BIOLOGY Unit 4: Plant Physiology

How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle?

↻ Repeated question — also appeared in 2023 (8 sets)

A. 12 ATP and 16 NADPH2
B. 18 ATP and 16 NADPH2
C. 12 ATP and 12 NADPH2
D. 18 ATP and 12 NADPH2

Correct answer & explanation hidden

Log in to view solution →

Q128 BIOLOGY Unit 10: Ecology and Environment

Identify the correct statements : A. Detrivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below :

↻ Repeated question — also appeared in 2023 (5 sets)

A. C, D, E only
B. D, E, A only
C. A, B, C only
D. B, C, D only

Correct answer & explanation hidden

Log in to view solution →

Q128 BIOLOGY Unit 10: Ecology and Environment

Identify the correct statements: A. Detritivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (5 sets)

A. C, D, E only
B. D, E, A only
C. A, B, C only
D. B, C, D only

Correct answer & explanation hidden

Log in to view solution →

Q129 BIOLOGY Unit 6: Reproduction

In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :

↻ Repeated question — also appeared in 2023 (8 sets)

A. Synergids, Zygote and Primary endosperm nucleus
B. Synergids, antipodals and Polar nuclei
C. Synergids, Primary endosperm nucleus and zygote
D. Antipodals, synergids, and primary endosperm nucleus

Correct answer & explanation hidden

Log in to view solution →

Q129 BIOLOGY Unit 6: Reproduction

In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are:

↻ Repeated question — also appeared in 2023 (8 sets)

A. Synergids, Zygote and Primary endosperm nucleus
B. Synergids, antipodals and Polar nuclei
C. Synergids, Primary endosperm nucleus and zygote
D. Antipodals, synergids, and primary endosperm nucleus

Correct answer & explanation hidden

Log in to view solution →

Q130 BIOLOGY Unit 4: Plant Physiology

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion A: ATP is used at two steps in glycolysis. Reason R: First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (6 sets)

A. A is true but R is false.
B. A is false but R is true.
C. Both A and R are true and R is the correct explanation of A.
D. Both A and R are true but R is NOT the correct explanation of A.

Correct answer & explanation hidden

Log in to view solution →

Q131 BIOLOGY Unit 7: Genetics and Evolution

Expressed Sequence Tags (ESTs) refers to:

↻ Repeated question — also appeared in 2023 (4 sets)

A. All genes whether expressed or unexpressed.
B. Certain important expressed genes.
C. All genes that are expressed as RNA.
D. All genes that are expressed as proteins.

Correct answer & explanation hidden

Log in to view solution →

Q132 BIOLOGY Unit 3: Cell Structure and Function

Among eukaryotes, replication of DNA takes place in:

↻ Repeated question — also appeared in 2023 (8 sets)

A. G1 phase
B. G2 phase
C. M phase
D. S phase

Correct answer & explanation hidden

Log in to view solution →

Q133 BIOLOGY Unit 2: Structural Organisation in Animals and Plants

Given below are two statements: Statement I: Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. Statement II: Exarch condition is the most common feature of the root system. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (7 sets)

A. Statement I is correct but Statement II is false.
B. Statement I is incorrect but Statement II is true.
C. Both Statement I and Statement II are true.
D. Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q134 BIOLOGY Unit 6: Reproduction

Large, colourful, fragrant flowers with nectar are seen in:

↻ Repeated question — also appeared in 2023 (6 sets)

A. bat pollinated plants
B. wind pollinated plants
C. insect pollinated plants
D. bird pollinated plants

Correct answer & explanation hidden

Log in to view solution →

Q135 BIOLOGY Unit 4: Plant Physiology

Which hormone promotes internode/petiole elongation in deep water rice?

↻ Repeated question — also appeared in 2023 (7 sets)

A. Ethylene
B. 2, 4-D
C. GA3
D. Kinetin

Correct answer & explanation hidden

Log in to view solution →

Q137 BIOLOGY Unit 3: Cell Structure and Function

Match List I with List II : List I | List II A. M Phase | I. Proteins are synthesized B. G$_2$ Phase | II. Inactive phase C. Quiescent stage | III. Interval between mitosis and initiation of DNA replication D. G$_1$ Phase | IV. Equational division Choose the correct answer from the options given below :

↻ Repeated question — also appeared in 2023 (7 sets)

A. A-IV, B-I, C-II, D-III
B. A-II, B-IV, C-I, D-III
C. A-III, B-II, C-IV, D-I
D. A-IV, B-II, C-I, D-III

Correct answer & explanation hidden

Log in to view solution →

Q138 BIOLOGY Unit 3: Cell Structure and Function

How many different proteins does the ribosome consist of?

↻ Repeated question — also appeared in 2023 (7 sets)

A. 40
B. 20
C. 80
D. 60

Correct answer & explanation hidden

Log in to view solution →

Q139 BIOLOGY Unit 10: Ecology and Environment

Which one of the following statements is NOT correct?

↻ Repeated question — also appeared in 2023 (8 sets)

A. Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body.
B. The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels.
C. The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms.
D. Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.

Correct answer & explanation hidden

Log in to view solution →

Q140 BIOLOGY Unit 4: Plant Physiology

Which of the following combinations is required for chemiosmosis?

↻ Repeated question — also appeared in 2023 (7 sets)

A. proton pump, electron gradient, ATP synthase
B. proton pump, electron gradient, NADP synthase
C. membrane, proton pump, proton gradient, ATP synthase
D. membrane, proton pump, proton gradient, NADP synthase

Correct answer & explanation hidden

Log in to view solution →

Q141 BIOLOGY Unit 4: Plant Physiology

Match List I with List II : List I | List II A. Cohesion | I. More attraction in liquid phase B. Adhesion | II. Mutual attraction among water molecules C. Surface tension | III. Water loss in liquid phase D. Guttation | IV. Attraction towards polar surfaces Choose the correct answer from the options given below :

↻ Repeated question — also appeared in 2023 (7 sets)

A. A-III, B-I, C-IV, D-II
B. A-II, B-I, C-IV, D-III
C. A-II, B-IV, C-I, D-III
D. A-IV, B-III, C-II, D-I

Correct answer & explanation hidden

Log in to view solution →

Q142 BIOLOGY Unit 4: Plant Physiology

Match List I with List II : List I | List II A. Iron | I. Synthesis of auxin B. Zinc | II. Component of nitrate reductase C. Boron | III. Activator of catalase D. Molybdenum | IV. Cell elongation and differentiation Choose the correct answer from the options given below :

↻ Repeated question — also appeared in 2023 (5 sets)

A. A-III, B-I, C-IV, D-II
B. A-II, B-IV, C-I, D-III
C. A-III, B-II, C-I, D-IV
D. A-II, B-III, C-IV, D-I

Correct answer & explanation hidden

Log in to view solution →

Q143 BIOLOGY Unit 10: Ecology and Environment

Given below are two statements : Statement I : Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. Statement II : In general, carnivores are more adversely affected by competition than herbivores. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (7 sets)

A. Statement I is correct but Statement II is false.
B. Statement I is incorrect but Statement II is true.
C. Both Statement I and Statement II are true.
D. Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q144 BIOLOGY Unit 4: Plant Physiology

Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of

↻ Repeated question — also appeared in 2023 (6 sets)

A. Lipase
B. Dinitrogenase
C. Succinic dehydrogenase
D. Amylase

Correct answer & explanation hidden

Log in to view solution →

Q145 BIOLOGY Unit 2: Structural Organisation in Animals and Plants

Identify the correct statements : A. Lenticels are the lens-shaped openings permitting the exchange of gases. B. Bark formed early in the season is called hard bark. C. Bark is a technical term that refers to all tissues exterior to vascular cambium. D. Bark refers to periderm and secondary phloem. E. Phellogen is single-layered in thickness. Choose the correct answer from the options given below :

↻ Repeated question — also appeared in 2023 (5 sets)

A. A, B and D only
B. B and C only
C. B, C and E only
D. A and D only

Correct answer & explanation hidden

Log in to view solution →

Q146 BIOLOGY Unit 6: Reproduction

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (3 sets)

A. A is true but R is false.
B. A is false but R is true.
C. Both A and R are true and R is the correct explanation of A.
D. Both A and R are true but R is NOT the correct explanation of A.

Correct answer & explanation hidden

Log in to view solution →

Q147 BIOLOGY Unit 7: Genetics and Evolution

Which of the following statements are correct about Klinefelter's Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine development is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below :

↻ Repeated question — also appeared in 2023 (8 sets)

A. B and E only
B. A and E only
C. A and B only
D. C and D only

Correct answer & explanation hidden

Log in to view solution →

Q147 BIOLOGY Unit 7: Genetics and Evolution

Which of the following statements are correct about Klinefelter's Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine development is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (8 sets)

A. B and E only
B. A and E only
C. A and B only
D. C and D only

Correct answer & explanation hidden

Log in to view solution →

Q148 BIOLOGY Unit 9: Biotechnology and Its Applications

Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell. B. Cutting of DNA at specific location by restriction enzyme. C. Isolation of desired DNA fragment. D. Amplification of gene of interest using PCR. Choose the correct answer from the options given below :

↻ Repeated question — also appeared in 2023 (8 sets)

A. C, B, D, A
B. B, D, A, C
C. B, C, D, A
D. C, A, B, D

Correct answer & explanation hidden

Log in to view solution →

Q148 BIOLOGY Unit 9: Biotechnology and Its Applications

Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell. B. Cutting of DNA at specific location by restriction enzyme. C. Isolation of desired DNA fragment. D. Amplification of gene of interest using PCR. Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (8 sets)

A. C, B, D, A
B. B, D, A, C
C. B, C, D, A
D. C, A, B, D

Correct answer & explanation hidden

Log in to view solution →

Q149 BIOLOGY Unit 4: Plant Physiology

Match List I with List II: List I | List II A. Oxidative decarboxylation | I. Citrate synthase B. Glycolysis | II. Pyruvate dehydrogenase C. Oxidative phosphorylation | III. Electron transport system D. Tricarboxylic acid cycle | IV. EMP pathway Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (5 sets)

A. A-III, B-I, C-II, D-IV
B. A-II, B-IV, C-III, D-I
C. A-III, B-IV, C-II, D-I
D. A-II, B-IV, C-I, D-III

Correct answer & explanation hidden

Log in to view solution →

Q150 BIOLOGY Unit 10: Ecology and Environment

↻ Repeated question — also appeared in 2023 (7 sets)

A. A-IV, B-III, C-I, D-II
B. A-III, B-I, C-IV, D-II
C. A-IV, B-II, C-I, D-III
D. A-IV, B-I, C-II, D-III

Correct answer & explanation hidden

Log in to view solution →

Q151 BIOLOGY Unit 7: Genetics and Evolution

Broad palm with single palm crease is visible in a person suffering from-

↻ Repeated question — also appeared in 2023 (7 sets)

A. Klinefelter's syndrome
B. Thalassemia
C. Down's syndrome
D. Turner's syndrome

Correct answer & explanation hidden

Log in to view solution →

Q152 BIOLOGY Unit 3: Cell Structure and Function

Given below are two statements: Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal) Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of $\alpha$ type and two subunits of $\beta$ type.) In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (1 set)

A. Statement I is true but Statement II is false.
B. Statement I is false but Statement II is true.
C. Both Statement I and Statement II are true.
D. Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q153 BIOLOGY Unit 5: Human Physiology

Given below are statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla. Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (7 sets)

A. A is true but R is false.
B. A is false but R is true.
C. Both A and R are true and R is the correct explanation of A.
D. Both A and R are true but R is NOT the correct explanation of A.

Correct answer & explanation hidden

Log in to view solution →

Q154 BIOLOGY Unit 8: Biology and Human Welfare

Match List I with List II. List I | List II A. Heroin | I. Effect on cardiovascular system B. Marijuana | II. Slow down body function C. Cocaine | III. Painkiller D. Morphine | IV. Interfere with transport of dopamine Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (5 sets)

A. A-IV, B-III, C-II, D-I
B. A-III, B-IV, C-I, D-II
C. A-II, B-I, C-IV, D-III
D. A-I, B-II, C-III, D-IV

Correct answer & explanation hidden

Log in to view solution →

Q155 BIOLOGY Unit 5: Human Physiology

Vital capacity of lung is __________.

↻ Repeated question — also appeared in 2023 (7 sets)

A. IRV + ERV + TV - RV
B. IRV + ERV + TV
C. IRV + ERV
D. IRV + ERV + TV + RV

Correct answer & explanation hidden

Log in to view solution →

Q156 BIOLOGY Unit 5: Human Physiology

Match List I with List II. List I | List II A. P-wave | I. Beginning of systole B. Q-wave | II. Repolarisation of ventricles C. QRS complex | III. Depolarisation of atria D. T-wave | IV. Depolarisation of ventricles Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (5 sets)

A. A-II, B-IV, C-I, D-III
B. A-I, B-II, C-III, D-IV
C. A-III, B-I, C-IV, D-II
D. A-IV, B-III, C-II, D-I

Correct answer & explanation hidden

Log in to view solution →

Q157 BIOLOGY Unit 5: Human Physiology

Match List I with List II. List I (Cells) | List II (Secretion) A. Peptic cells | I. Mucus B. Goblet cells | II. Bile juice C. Oxyntic cells | III. Proenzyme pepsinogen D. Hepatic cells | IV. HCl and intrinsic factor for absorption of vitamin B12 Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (6 sets)

A. A-III, B-I, C-IV, D-II
B. A-II, B-IV, C-I, D-III
C. A-IV, B-III, C-II, D-I
D. A-II, B-I, C-III, D-IV

Correct answer & explanation hidden

Log in to view solution →

Q158 BIOLOGY Unit 6: Reproduction

↻ Repeated question — also appeared in 2023 (4 sets)

A. A-II, B-III, C-I, D-IV
B. A-IV, B-II, C-I, D-III
C. A-III, B-I, C-IV, D-II
D. A-III, B-IV, C-II, D-I

Correct answer & explanation hidden

Log in to view solution →

Q159 BIOLOGY Unit 6: Reproduction

Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?

↻ Repeated question — also appeared in 2023 (3 sets)

A. Hepatitis-B
B. HIV Infection
C. Genital herpes
D. Gonorrhoea

Correct answer & explanation hidden

Log in to view solution →

Q160 BIOLOGY Unit 8: Biology and Human Welfare

↻ Repeated question — also appeared in 2023 (6 sets)

A. A-III, B-II, C-I, D-IV
B. A-III, B-II, C-IV, D-I
C. A-II, B-III, C-IV, D-I
D. A-II, B-III, C-I, D-IV

Correct answer & explanation hidden

Log in to view solution →

Q161 BIOLOGY Unit 3: Cell Structure and Function

Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic Reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options given below:

↻ Repeated question — also appeared in 2023 (7 sets)

A. A and D only
B. A, D and E only
C. B and D only
D. A, C and E only

Correct answer & explanation hidden

Log in to view solution →

Q162 BIOLOGY Unit 9: Biotechnology and Its Applications

Which of the following is not a cloning vector?

↻ Repeated question — also appeared in 2023 (7 sets)

A. pBR322
B. Probe
C. BAC
D. YAC

Correct answer & explanation hidden

Log in to view solution →

Q163 BIOLOGY Unit 10: Ecology and Environment

Match List I with List II. List I (Interacting species) | List II (Name of Interaction) A. A Leopard and a Lion in a forest/grassland | I. Competition B. A Cuckoo laying egg in a Crow's nest | II. Brood parasitism C. Fungi and root of a higher plant in Mycorrhizae | III. Mutualism D. A cattle egret and a Cattle in a field | IV. Commensalism Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (5 sets)

A. A-III, B-IV, C-I, D-II
B. A-II, B-III, C-I, D-IV
C. A-I, B-II, C-III, D-IV
D. A-I, B-II, C-IV, D-III

Correct answer & explanation hidden

Log in to view solution →

Q164 BIOLOGY Unit 7: Genetics and Evolution

Which one of the following symbols represents mating between relatives in human pedigree analysis?

↻ Repeated question — also appeared in 2023 (4 sets)

A. (1)
B. (2)
C. (3)
D. (4)

Correct answer & explanation hidden

Log in to view solution →

Q165 BIOLOGY Unit 5: Human Physiology

A. A-III, B-II, C-IV, D-I
B. A-II, B-I, C-IV, D-III
C. A-I, B-II, C-III, D-IV
D. A-I, B-II, C-IV, D-III

Correct answer & explanation hidden

Log in to view solution →

Q166 BIOLOGY Unit 5: Human Physiology

Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by-

↻ Repeated question — also appeared in 2023 (7 sets)

A. Gastro-oesophageal sphincter
B. Pyloric sphincter
C. Sphincter of Oddi
D. Ileo-caecal valve

Correct answer & explanation hidden

Log in to view solution →

Q167 BIOLOGY Unit 7: Genetics and Evolution

↻ Repeated question — also appeared in 2023 (8 sets)

A. A-III, B-IV, C-I, D-II
B. A-III, B-I, C-IV, D-II
C. A-II, B-I, C-IV, D-III
D. A-II, B-III, C-IV, D-I

Correct answer & explanation hidden

Log in to view solution →

Q167 BIOLOGY Unit 7: Genetics and Evolution

↻ Repeated question — also appeared in 2023 (8 sets)

A. A-III, B-IV, C-I, D-II
B. A-III, B-I, C-IV, D-II
C. A-II, B-I, C-IV, D-III
D. A-II, B-III, C-IV, D-I

Correct answer & explanation hidden

Log in to view solution →

Q168 BIOLOGY Unit 9: Biotechnology and Its Applications

Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?

↻ Repeated question — also appeared in 2023 (6 sets)

A. Polymerase Chain Reaction (PCR) technique
B. Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
C. Recombinant DNA Technology
D. Serum and Urine analysis

Correct answer & explanation hidden

Log in to view solution →

Q168 BIOLOGY Unit 9: Biotechnology and Its Applications

Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?

↻ Repeated question — also appeared in 2023 (6 sets)

A. Polymerase Chain Reaction (PCR) technique
B. Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
C. Recombinant DNA Technology
D. Serum and Urine analysis

Correct answer & explanation hidden

Log in to view solution →

Q169 BIOLOGY Unit 5: Human Physiology

Given below are two statements: Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the options given below:

A. Statement I is true but Statement II is false.
B. Statement I is false but Statement II is true.
C. Both Statement I and Statement II are true.
D. Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q169 BIOLOGY Unit 3: Cell Structure and Function

Given below are two statements: Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (6 sets)

A. Statement I is true but Statement II is false.
B. Statement I is false but Statement II is true.
C. Both Statement I and Statement II are true.
D. Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q170 BIOLOGY Unit 5: Human Physiology

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Endometrium is necessary for implantation of blastocyst. Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (2 sets)

A. A is true but R is false.
B. A is false but R is true.
C. Both A and R are true and R is the correct explanation of A.
D. Both A and R are true but R is NOT the correct explanation of A.

Correct answer & explanation hidden

Log in to view solution →

Q171 BIOLOGY Unit 5: Human Physiology

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. Reason R: Ban on amniocentesis checks increasing menace of female foeticide. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (1 set)

A. A is true but R is false.
B. A is false but R is true.
C. Both A and R are true and R is the correct explanation of A.
D. Both A and R are true and R is NOT the correct explanation of A.

Correct answer & explanation hidden

Log in to view solution →

Q172 BIOLOGY Unit 10: Ecology and Environment

Which of the following statements is correct?

↻ Repeated question — also appeared in 2023 (8 sets)

A. Presence of large amount of nutrients in water restricts 'Algal Bloom'
B. Algal Bloom decreases fish mortality
C. Eutrophication refers to increase in domestic sewage and waste water in lakes.
D. Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.

Correct answer & explanation hidden

Log in to view solution →

Q173 BIOLOGY Unit 6: Reproduction

Which of the following statements are correct regarding female reproductive cycle? A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. B. First menstrual cycle begins at puberty and is called menopause. C. Lack of menstruation may be indicative of pregnancy. D. Cyclic menstruation extends between menarche and menopause. Choose the most appropriate answer from the options given below:

↻ Repeated question — also appeared in 2023 (5 sets)

A. A, B and C only
B. A, C and D only
C. A and D only
D. A and B only

Correct answer & explanation hidden

Log in to view solution →

Q174 BIOLOGY Unit 5: Human Physiology

↻ Repeated question — also appeared in 2023 (4 sets)

A. A-II, B-IV, C-I, D-III
B. A-IV, B-II, C-III, D-I
C. A-IV, B-III, C-II, D-I
D. A-III, B-II, C-IV, D-I

Correct answer & explanation hidden

Log in to view solution →

Q175 BIOLOGY Unit 7: Genetics and Evolution

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (6 sets)

A. Statement I is correct but Statement II is false.
B. Statement I incorrect but Statement II is true.
C. Both Statement I and Statement II are true.
D. Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q175 BIOLOGY Unit 3: Cell Structure and Function

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (1 set)

A. Statement I is correct but Statement II is false.
B. Statement I incorrect but Statement II is true.
C. Both Statement I and Statement II are true.
D. Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q176 BIOLOGY Unit 5: Human Physiology

Match List I with List II: List I (Type of Joint) | List II (Found between) A. Cartilaginous Joint | I. Between flat skull bones B. Ball and Socket Joint | II. Between adjacent vertebrae in vertebral column C. Fibrous Joint | III. Between carpal and metacarpal of thumb D. Saddle Joint | IV. Between Humerus and Pectoral girdle Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (7 sets)

A. A-I, B-IV, C-III, D-II
B. A-II, B-IV, C-III, D-I
C. A-III, B-I, C-II, D-IV
D. A-II, B-IV, C-I, D-III

Correct answer & explanation hidden

Log in to view solution →

Q177 BIOLOGY Unit 2: Structural Organisation in Animals and Plants

Given below are two statements: Statement I: Ligaments are dense irregular tissue. Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (6 sets)

A. Statement I is true but Statement II is false.
B. Statement I is false but Statement II is true.
C. Both Statement I and Statement II are true.
D. Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q178 BIOLOGY Unit 8: Biology and Human Welfare

In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?

↻ Repeated question — also appeared in 2023 (7 sets)

A. Basophils
B. Eosinophils
C. TH cells
D. B-lymphocytes

Correct answer & explanation hidden

Log in to view solution →

Q179 BIOLOGY Unit 1: Diversity in Living World

Radial symmetry is NOT found in adults of phylum ______.

↻ Repeated question — also appeared in 2023 (7 sets)

A. Coelenterata
B. Echinodermata
C. Ctenophora
D. Hemichordata

Correct answer & explanation hidden

Log in to view solution →

Q180 BIOLOGY Unit 3: Cell Structure and Function

Which of the following functions is carried out by cytoskeleton in a cell?

↻ Repeated question — also appeared in 2023 (7 sets)

A. Motility
B. Transportation
C. Nuclear division
D. Protein synthesis

Correct answer & explanation hidden

Log in to view solution →

Q181 BIOLOGY Unit 6: Reproduction

Given below are two statements: Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (4 sets)

A. Statement I is correct but Statement II is false.
B. Statement I incorrect but Statement II is true.
C. Both Statement I and Statement II are true.
D. Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q182 BIOLOGY Unit 7: Genetics and Evolution

Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.

↻ Repeated question — also appeared in 2023 (7 sets)

A. Mole, Flying squirrel, Tasmanian tiger cat
B. Lemur, Anteater, Wolf
C. Tasmanian wolf, Bobcat, Marsupial mole
D. Numbat, Spotted cuscus, Flying phalanger

Correct answer & explanation hidden

Log in to view solution →

Q183 BIOLOGY Unit 10: Ecology and Environment

Given below are two statements: Statement I: Electrostatic precipitator is most widely used in thermal power plant. Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations. In the light of the above statements, choose the most appropriate answer from the options given below:

↻ Repeated question — also appeared in 2023 (7 sets)

A. Statement I is correct but Statement II is incorrect.
B. Statement I incorrect but Statement II is correct.
C. Both Statement I and Statement II are correct.
D. Both Statement I and Statement II are incorrect.

Correct answer & explanation hidden

Log in to view solution →

Q184 BIOLOGY Unit 7: Genetics and Evolution

Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (7 sets)

A. Statement I is true but Statement II is false.
B. Statement I false but Statement II is true.
C. Both Statement I and Statement II are true.
D. Both Statement I and Statement II are false.

Correct answer & explanation hidden

Log in to view solution →

Q185 BIOLOGY Unit 5: Human Physiology

Match List I with List II with respect to human eye. List I (A) Fovea, (B) Iris, (C) Blind spot, (D) Sclera List II (I) Visible coloured portion of eye that regulates diameter of pupil, (II) External layer of eye formed of dense connective tissue, (III) Point of greatest visual acuity or resolution, (IV) Point where optic nerve leaves the eyeball and photoreceptor cells are absent.

A. A-I, B-IV, C-III, D-II
B. A-II, B-I, C-III, D-IV
C. A-III, B-I, C-IV, D-II
D. A-IV, B-III, C-II, D-I

Correct answer & explanation hidden

Log in to view solution →

Q185 BIOLOGY Unit 5: Human Physiology

↻ Repeated question — also appeared in 2023 (5 sets)

A. A-I, B-IV, C-III, D-II
B. A-II, B-I, C-III, D-IV
C. A-III, B-I, C-IV, D-II
D. A-IV, B-III, C-II, D-I

Correct answer & explanation hidden

Log in to view solution →

Q186 BIOLOGY Unit 3: Cell Structure and Function

Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (6 sets)

A. A, C and E only
B. B and E only
C. A and C only
D. B and D only

Correct answer & explanation hidden

Log in to view solution →

Q189 BIOLOGY Unit 2: Structural Organisation in Animals and Plants

↻ Repeated question — also appeared in 2023 (3 sets)

A. A-II, B-I, C-IV, D-III
B. A-III, B-IV, C-II, D-I
C. A-I, B-II, C-IV, D-III
D. A-II, B-III, C-I, D-IV

Correct answer & explanation hidden

Log in to view solution →

Q190 BIOLOGY Unit 3: Cell Structure and Function

Given below are two statements: Statement I: During G0 phase of cell cycle, the cell is metabolically inactive. Statement II: The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:

↻ Repeated question — also appeared in 2023 (6 sets)

A. Statement I is correct but Statement II is incorrect.
B. Statement I is incorrect but Statement II is correct.
C. Both Statement I and Statement II are correct.
D. Both Statement I and Statement II are incorrect.

Correct answer & explanation hidden

Log in to view solution →

Q191 BIOLOGY Unit 8: Biology and Human Welfare

Which one of the following is NOT an advantage of inbreeding?

↻ Repeated question — also appeared in 2023 (7 sets)

A. Elimination of less desirable genes and accumulation of superior genes takes place due to it.
B. It decreases the productivity of inbred population, after continuous inbreeding.
C. It decreases homozygosity.
D. It exposes harmful recessive genes that are eliminated by selection.

Correct answer & explanation hidden

Log in to view solution →

Q192 BIOLOGY Unit 2: Structural Organisation in Animals and Plants

Which of the following is characteristic feature of cockroach regarding sexual dimorphism?

↻ Repeated question — also appeared in 2023 (6 sets)

A. Presence of sclerites
B. Presence of anal cerci
C. Dark brown body colour and anal cerci
D. Presence of anal styles

Correct answer & explanation hidden

Log in to view solution →

Q193 BIOLOGY Unit 5: Human Physiology

The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are:

↻ Repeated question — also appeared in 2023 (7 sets)

A. Brain stem & epithalamus
B. Corpus callosum and thalamus
C. Limbic system & hypothalamus
D. Corpora quadrigemina & hippocampus

Correct answer & explanation hidden

Log in to view solution →

Q194 BIOLOGY Unit 5: Human Physiology

Which of the following statements are correct? A. Basophils are most abundant cells of the total WBCs B. Basophils secrete histamine, serotonin and heparin C. Basophils are involved in inflammatory response D. Basophils have kidney shaped nucleus E. Basophils are agranulocytes Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (7 sets)

A. B and C only
B. A and B only
C. D and E only
D. C and E only

Correct answer & explanation hidden

Log in to view solution →

Q195 BIOLOGY Unit 7: Genetics and Evolution

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?

↻ Repeated question — also appeared in 2023 (6 sets)

A. 5' ATCGATCGATCGATCGATCGATCGATCG 3'
B. 3' ATCGATCGATCGATCGATCGATCGATCG 5'
C. 5' UAGCUAGCUAGCUAGCUAGCUAGC 3'
D. 3' UAGCUAGCUAGCUAGCUAGCUAGC 5'

Correct answer & explanation hidden

Log in to view solution →

Q196 BIOLOGY Unit 10: Ecology and Environment

↻ Repeated question — also appeared in 2023 (5 sets)

A. A-II, B-IV, C-I, D-III
B. A-II, B-IV, C-III, D-I
C. A-II, B-I, C-III, D-IV
D. A-II, B-III, C-I, D-IV

Correct answer & explanation hidden

Log in to view solution →

Q196 BIOLOGY Unit 10: Ecology and Environment

Match List I with List II. List I | List II A. Logistic growth | I. Unlimited resource availability condition B. Exponential growth | II. Limited resource availability condition C. Expanding age pyramid | III. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups D. Stable age pyramid | IV. The percent individuals of pre-reproductives and reproductive age group are same Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (5 sets)

A. A-II, B-IV, C-I, D-III
B. A-II, B-IV, C-III, D-I
C. A-II, B-I, C-III, D-IV
D. A-II, B-III, C-I, D-IV

Correct answer & explanation hidden

Log in to view solution →

Q197 BIOLOGY Unit 5: Human Physiology

Which of the following are NOT under the control of thyroid hormone? A. Maintenance of water and electrolyte balance B. Regulation of basal metabolic rate C. Normal rhythm of sleep-wake cycle D. Development of immune system E. Support the process of R.B.Cs formation Choose the correct answer from the options given below:

↻ Repeated question — also appeared in 2023 (8 sets)

A. C and D only
B. D and E only
C. A and D only
D. B and C only

Correct answer & explanation hidden

Log in to view solution →